CR01322

CRIMIC CR01322

Gene Arr1

CG5711

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ACGCGAGCAAGCAAACCAAGAGG

Amplicon 5' Amplicon 3'
GACGAGTGCTTAGGGCTCAATTAAATTAACAACAATTACGTAAATGGAAAAGAACAAAACCCACCACGTAATGTTTGGGTTTAAATACGTCATCCTAGGCGGAAAACAACAAACCAAAATACGCATACTAAATCGATTTCTCGAGCTATTTCTGTACATTCACCTGTCCTGCATTGCTAATACGCCGTGTTGCTCGCGCGTTATTTAATGTTTGAGCCATCGATGTCGATGTCGTGCTGCAATGTCAATATCAAAGACACTGCGCACAGCAAGGTTGCCGAAGCCGTAGTAGTTTACCGCCGTGCAATTGCTGAATTTCTGCTGTGCGGCTAATTGAATTTAGAGGGGCGACAGGTGCCACAATGCCAGGTATAAATGCCGGATTGCCAAAGAGCGCTAATTAATAGCCTAGTGGACCACGCAACGCGGCGTATACCATCGAGAACGAGCGCGAAACGTTAAAGGCACATCCAAAGTTTAAACTATTTCCGCAGAGATTTTGATAAACAGCTCCAAAATGGTGGTCAATTTCAAGGTGTTCAAGAAGTGTTCCCCGAACAACATGATCACGCTCTACATGAACAGGCGTGATTTTGTAGATTCCGTGACTCAGGTGGAACCCATTGGTAGGTGTCACAGACCGAAACCCTTGAGCAATGGGATTTACGAATGAGGAAATCCATCAAAAAATAAATTCGTGTAGGAATTGGTACCCATATTCGATTGAAGTATCTTATAGTTTGAAAATAACTTCAGTGTAACTTTTGTTTCAACTTAACACATTGGAATTTTTAATACCTTCCTTGAAAAGTGATATCAAATCAAAATTATATTATAAAAACTCCATTTCGAATCTGCATATGCCGACCAGCAAATATAAACTCAGGGAGTTATTCAAAATTGCATCTGAATTCAATAGCCCAGGGAGTTAAGTTAAATTGGCTGCGCTAGCAGCTAACCAAGTTCATCGATTACGCGAGCAAGCAA AGGCTGGGCGCTTGTAAATAATATTCTCCAATTAATAAGCGTCCTCTTGCAGATGGAATCATTGTGCTGGACGATGAGTACGTGCGCCAGAACCGCAAGATCTTCGTGCAGTTGGTCTGCAATTTCCGATATGGGCGCGAGGACGACGAGATGATCGGTCTGCGGTTCCAGAAGGAACTGACCCTGGTCTCGCAGCAGGTGTGCCCACCCCAGAAGCAGGACATCCAGTTGACCAAGATGCAGGAGCGTCTGCTGAAGAAGCTTGGCTCCAATGCCTATCCCTTCGTGATGCAGATGCCACCAAGCTCGCCGGCCTCGGTGGTTCTCCAGCAGAAGGCCAGTGACGAGAGCCAGCCCTGCGGAGTCCAGTACTTCGTAAAGATCTTTACCGGAGACAGCGACTGCGATCGATCGCATCGCAGGAGCACCATTAACCTGGGCATCCGCAAGGTGCAGTACGCACCGACCAAGCAGGGCATCCAGCCCTGCACCGTCGTTCGCAAGGACTTCCTTCTGTCGCCCGGAGAGCTCGAACTGGAGGTCACCCTCGACAAGCAGCTGTACCATCACGGCGAGAAGATCTCGGTGAACATCTGCGTGCGCAACAACTCCAACAAGGTGGTGAAGAAGATCAAGGCCATGGTGCAGCAGGGCGTCGATGTGGTCCTGTTCCAGAACGGTCAGTTCCGCAACACGATCGCCTTCATGGAGACGAGCGAGGGATGTCCCCTGAACCCGGGATCCAGCCTGCAGAAGGTCATGTATCTGGTGCCCACCCTGGTGGCCAATTGCGACCGCGCAGGCATCGCCGTTGAGGGTGATA


Search Again