CR01320

CRIMIC CR01320

Gene S

CG4385

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OK83265

Images

Construct Sequences

sgRNA sequence
AGTAAGTACCTCATAAGAAGTGG

Amplicon 5' Amplicon 3'
AATCCGGGATCTGGAATGGCGTGCTCGCCCTGGATCCGCATGTCCTATTGCCATTGCCTAGTAGTTTGGCTCGGTTGGTCTATTGATTTGTGCTTCTTGTCTGGCTTGTAATTACAAGCTCGTACGCCGCCATTCAAAATGGCCTGTTTCCATGTTGATAACGTGAAATGTTCCCATCCATGAACACGTCTTGCATGTGGTAACAGAACAGGCAACGCAAGCGCTGATTTATTTAGCAAATAGGTCCAAGTGGGCCTAATCTATGTGGGTCGGATCTTAATCACCGCCTGCAAAGCGCATTTAGTTGTGGCGAAATGGAAAAGGCCAATGCAGGGCAAACATGTACGTCACGTGATCAGGTGTGAAATGCATTAAGTGGGTGGAAAAACAAGGGAAAAGTGCGATTTAAAAGGTTGAATCGAAAAGAGCACCAACTACTAGCGAATGAAATGAAATATTTTATTAAACATTACCAATTCAGACTGATATATGACAGCGTGGCACTCTGTATGATGATATATGACCCATTGAGACGTGTCAAGAAACCTTTGGCATGGTAAATGACCCCGTTTTAATGCGTTAAACGTTCCCTTTAGCCATTAATCAACCCCGATTGAAATATCTTCCAGCGAAATCCCGATAAAGCAGACACGAGACCGAGACCAGTTGTTCAGCCCCCGCTGTTGTTGTTTTCCTTATTAACCTTATCGCAGTGGGCACTTTTCCAAGGAGAACCCACACGACGCCTAAGAAACGGCGCAATTGCAATGCCACAAGGAGGGTTGCAAAACCCGAGACCCACATGCGGGTGGTGGCTCTGCGGAAAGAAGGCAGGCGGGCGGAGTAAGTACCTCA CCTCTAGTCATCGTGAGTCGCCGTGGCGCATGCTGTGATAATGCCGTTTGAGCTTTGCTTTTCAAATTGAGCACTCGCTGCGCTTTTCACGGAGCTGATCATCTCCGCCGGAGGCTCGAACGAACCGGGCGAACCACTTGCACCACCGCGACGAAGCGCAGACCATGCCACGCAGTCCAGACGACGACAGCGACGCCTCTGCGGGGGTGGCTTTTTCCCCCCCGGGCTGGGGGCCATGCAACAATGTTGGCAACTGCACACGAAAATTATGAATCACGAGGCAAACTAAGTCGGTGGGAGGAGGGCCCACAATGACATCCGGTGGCTAGCAGGGGAGGTTAATGCTACACACGAAGAAACAAGAGGACAAATTTAGTTAATAGTCGAAGGTTATCAGTCGATAATGTGAGACTTTGTTATAAAAGGGTCGCTGAATAAGGCATATCCAATGTAGCAAAGAAATCTTTTAAAGTTCCAAGATTTTAATTTAGATGTAGGATCAAAGTCTTAATATTCTGCAAAGTACTTAAGACTGGTTAGAAACTGCCAGACTAATAGGGGATTTGTCGTGACCCCTCCCCTTCCACTTTGAATTCCCTACGAACCCGCTGCGTGCCTAACGGGAATTAAGTCATTAGTGGTTGGTGTGTGTGTGCTGTGTGTGTGGTGTGTGTGCAATGGAGTTCAAGTTGTAAATTTCAATTAAAGTTGCAATTTGCAAATTGTCACCAGTGAAGGCCAGACGACAGTGACGACGACATCGTGTAATCACCGCAAGTGTGAAGATAATGCCGTCCTAACATGATTAATGCCCTGACCTTTGGGGGCGTGTTCGCTAGCGTTCGAAGTGCACGGCAAAAAAAACTAGTGTGGGTAGTTAATTATATTGTAATGTGTTGTTACCCAATTCACAATTTTACTTCCTTGTTATCGAACCATAAACATAGTTGCGCACAAATGGGCTAA


Search Again