CR01315

CRIMIC CR01315

Gene MCPH1

CG42572

Information

Donor Location Cytology FBti Stock number
pM37-p02R:11900732..1190074348C5FBti020689283264

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK

Images

Construct Design Sequences

sgRNA sequence CGCAGGATTCAGCGTGAAGCGGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GGGTAAACAATTGCTGCGCA GCTGAATCCTGCGGCATG CTCTGTGGTACGGACAGCTG AACAGATAGCCGGCAAGAGG
 
Amplicon 5' Amplicon 3'
GGGTAAACAATTGCTGCGCAACAATTAAGAAAACTTGTTCGCCCTGTCTGTGTACACGCGAATAAATCTCGGGAGTACAATTCCATACCAGCCGGTGACGGGCACGGAAAAGCAGCTCTAACTGTGCAAGATGATTCCAGGCTATGGACCCGTCACGCAGGCTCTGCTGGGCACCCTGCTTACCTGGGGACTGACCGCCGCTGGCGCCGCCCTAGTGATCTTCGTCCGGGGTAACCAGCGGAGGTCTCTGGACGCCGCCCTGGGATTCGCAGCTGGCGTAATGATAGCAGCCTCCTTTTGGTCACTCCTCAAGCCGGCCATCGAAATGGCCGAGAGTTCCCATTTGTACGGAGTATACGCCTTTCTGCCCGTCGCTGGAGGCTTCCTCTTGGGATCGATCTTCGTCTACGGATGCGACAAATTGATGTCATACCTGGGCCTTAACAGCACCAACATGATGATCCAGATGACGCAATCAAAAGCCAAGGCGGACATAGCCATCGAGGACTCTAAGCGCAATGGAGTTGCCCCCGATAGGTTGGCCTCAAAGAGTCTGGACAGCTTCTCCGACTGCCTTAGCGTGCAGCACAGCGGCGAATCGAGACGCCGAAAGAAGGGAGCTAGCATCAACGAGATGGAGCAGTGCACCTACACCACGCCTGAGGAGCAGCAGCGCGCCGAGGACGCCCTGTCCCAGTGGAAGAGGATTATGCTTTTGGTCGTGGCCATCACGGTCCACAACATTCCAGAAGGGCTGGCTGTGGGCGTAAGCTTTGGTGCCATTGGCTCCACGAACTCATCGACATTTGAGAGCGCCCGCAATTTGGCCATTGGCATTGGCATTCAAAACTTCCCCGAGGGATTGGCTGTCAGCTTGCCACTGCATGCCGCAGGATTCAGC CTCTGTGGTACGGACAGCTGTCCGGAATGGTGGAGCCCATTTTTGGAGTTCTGGGCGCCGTGGCGGTGACCTTTGCCAACCTGATCCTGCCATACGCCTTGTCTTTTGCGGCCGGAGCCATGATATACATTGTGTCGGACGACATTCTGCCGGAGGCTCATGCCAGCGGAAATGGAACGATCGCCACGTGGGGCACTGTATCCGGCTTCCTGATCATGATGTGTCTGGAGGTGGCGCTGTCGTGAGGAACGAACGGCTCGCCTTCGCCCGCCTCGCAGATTTCATAATCTAGTGCTAAACTCAAAGATTCCACTGTACTTAACGCAAAACTCTGCTGTCTTGTAAATAGAAGCATGCTGTGTACAAATCTCAGAACCAGCCCTAAACGAGAATCTAATAATCTAGCGTAGAGTGTAAGTTTTGTAGAAAGAAGCTTGACAACCAGCGATGCCGCGACGACATCCGTGCAATTGTGTATCTGTGCACACGTATCTGTACAGCATTCCCAGCGAGTTATGTAAATGAACTGTTCTAGGAAAATTTGTAAACAAACGTGCATGTGAATTAGGTTTTAAGTTGTCACCGGCGTCCAGTAGCTTGTGTCTTTTTTAACCGTCTAATGTCTAAGTAATAAACTAAACGAATTCAAATGAACATCTCTCAGTTGCACCCACTCGCTTTTTTCCCTCACAAATGTAGCTGTCTCCGTCCGGACAACTTCCTGACCGTTTCTTTGGCCGTACGATAGCTGATAAGGGCAAGTAAATTCACTTAGATAACCCGGAGTGCCAACAACAACAACAGCTGGTTGACTCGCTGTCAGCCAGTGATAAGTGATAAGAATCTGTCCGACACGAAGAGTTCCCAATATTGCGCGTATTCCGTGTTTGAGATACGTGCAGTTTCAGACGGCCCGCGGTCCTGCGTTTCTGTTCGCCATTTTCTGGATTAACTAATCATTTCAGATATGTATGTTTGTACTCGCACAAGTGCTTTGGGCCACAGTCCACCCACTGTGATCGTGGTCATCAGGAAAAGTGGTCGATAAGACCTCTTGCCGGCTATCTGTT
 

Search Again