CR01314

CRIMIC CR01314

Gene CG12769

CG12769

Information

Donor Location Cytology FBti Stock number
pM37-p02R:8055467..805548444A4FBti020689183263

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK short band

Images

Construct Design Sequences

sgRNA sequence GATGGAAGTTCGGTTCATAGTGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
AGTGGCAGGTGAGAATCAGC CACTTCATCTGCATGCGAAGG TGAACCGAACTTCCATCTCAT GTCACGGCATCGATCTGGAT
 
Amplicon 5' Amplicon 3'
AGTGGCAGGTGAGAATCAGCTTGCGGTTGATCAGCAGGTCTCCATCCTGGCCAGTCGACGTGATGGTCCCGTTGCAGATGGGCGTCGAGCTAGCACCATTGGTGGCACTGGGTGTCGCCGGTGTGGGTGGTCCGCCGCCTCCACCTCCTCCGCTGCCGCCATTCACTCCGGGTGATCCGCGACCGGATCCGTTGCTCAGGCTGTTGGACAGCACGGAATTGTTGTTGTTACTCTCCAGCGGCGTGGCATTCCGGGTGATCCGGTTGTTGGCCTTTGCGCAGATGCGACGCTTGAGATCCTCGCGTAGGAGCGATTTCAGTGGCGAGACCTGGTCCAAAATCAGGTGGATTAATATGGTGGCTATATATTGTATAATTCTTATTAACCCACCTTGATCAGTGAGGTGATTCTGTTGTTGTTGCTGCTGCTGTTGTTATTGTTGGAAGCCTGTTCTGTATCGCTGCTTGGATCACTACCGTTCATCAGGTCCTTCTTGTCCATATCCTCCGACATGGGCTCCTTTTGGGCAATAAGAGAAAAATTTATTTTTTTTTAACACGGAATATAAATGTAGATAATATTTATGATTTTGTTGGTATCTCATTTATTCATTGAACATAATTCTATACTACAACGTAACGATTTTGGGAAAAAAATTAAATTAATATATTATGAACCTGTTAAATCGATTAAAATACTAATATTAAAAAAAAAATAATTCAATCATTTCCATGCACAGAATTTAATACATAATTCATGGCATTTCAAATCATGAAAATTTACTCTAACATTTATTTTACAGGTCAAGATCAAACGCTGAATCAACCATCAAAATAAAACCCCTGGATCTCAACAGTCTATTGGAGCCAGTTCAGCCAAATTAGGTATGCAGTCTTTTATGATGCACAACAGGTTTTCAAAAAATGGTTCCGCCTTCGCATGCAGATGAAGTG TGAACCGAACTTCCATCTCATAAAGATGAATATTTACAAATTTGAGTTCGATCTGAATTCCTCTTTTCAGTAGGTGGAATTTATGATGTTTGATCTTCAGTTTCGAAGGGAACTACGTAGTTGAGATCCAAATACCTATTCTGGTAATATAAATTCACATACACCCTTCCGTAGCCCCATTTGATAAACCCAATAGATAGATATAATACATAATGCCGATCGCCCGATCTTGCCACTCGTCAACTCACCTGTTTGATAGGTATAAGACTGATCGACGGCGTTATGTGGTTCTCGTGGTGGTGATGGTGGTGGTGATGGTGATGCGGATGCTGGTGATGGCTCTTCAGGCCGCCACTCAGACTGCTGGCTGTGGTGCTGGATGTGATGGGCGTGGCCTTTGTGTTGCAATCCATTGGCAACTCCACCGGGGATTGCATGATGAGGGCTCGATCTTTCACCTTATCGCCATTGGACTCGGCATTTCCATTGCTAATGGAGTTGCAGTTGTTGCTCGCTCCATTTATATTGTTATTGTTGTTGGTAGCGCAGTTGTTGTTATTATTGTTGTTGTTGTTGCCCTGTAATGCAGATTCACGCCAAACGCAAATCAGCTAGTTTATCATTTGTAAGCGAGGGGGCTTGAAAAAGGGATGGGCTGCCATACAGCGATTGACTTACATTAAACAACTCCGTGTTGCCACTCTCGCCCAGCGTCGAGATCTCCACGTGGGGCGTGAGGAAGTGCATGGGGGGCGTGGCATTCTCCAGGGATCGCATGGACTCGCCGCTATCGCTAGCCGGAGGAGCCACCTGTTGCTGCTGCTGCTGCTGGGACTGAGATTGCACGGGCACCGGACTAAGTCCAGGTGGCACGTAACTAGCTGCCGCCGCTGCTGCCGCCGCCGAAGCCTGTGATTCCAGGGCCAGGAGCAACGAAGAGGTGCCACCCGGTCCCGGGTTATCCAGATCGATGCCGTGAC
 

Search Again