CR01314

CRIMIC CR01314

Gene CG12769

CG12769

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK short band83263

Images

Construct Sequences

sgRNA sequence
GATGGAAGTTCGGTTCATAGTGG

Amplicon 5' Amplicon 3'
AGTGGCAGGTGAGAATCAGCTTGCGGTTGATCAGCAGGTCTCCATCCTGGCCAGTCGACGTGATGGTCCCGTTGCAGATGGGCGTCGAGCTAGCACCATTGGTGGCACTGGGTGTCGCCGGTGTGGGTGGTCCGCCGCCTCCACCTCCTCCGCTGCCGCCATTCACTCCGGGTGATCCGCGACCGGATCCGTTGCTCAGGCTGTTGGACAGCACGGAATTGTTGTTGTTACTCTCCAGCGGCGTGGCATTCCGGGTGATCCGGTTGTTGGCCTTTGCGCAGATGCGACGCTTGAGATCCTCGCGTAGGAGCGATTTCAGTGGCGAGACCTGGTCCAAAATCAGGTGGATTAATATGGTGGCTATATATTGTATAATTCTTATTAACCCACCTTGATCAGTGAGGTGATTCTGTTGTTGTTGCTGCTGCTGTTGTTATTGTTGGAAGCCTGTTCTGTATCGCTGCTTGGATCACTACCGTTCATCAGGTCCTTCTTGTCCATATCCTCCGACATGGGCTCCTTTTGGGCAATAAGAGAAAAATTTATTTTTTTTTAACACGGAATATAAATGTAGATAATATTTATGATTTTGTTGGTATCTCATTTATTCATTGAACATAATTCTATACTACAACGTAACGATTTTGGGAAAAAAATTAAATTAATATATTATGAACCTGTTAAATCGATTAAAATACTAATATTAAAAAAAAAATAATTCAATCATTTCCATGCACAGAATTTAATACATAATTCATGGCATTTCAAATCATGAAAATTTACTCTAACATTTATTTTACAGGTCAAGATCAAACGCTGAATCAACCATCAAAATAAAACCCCTGGATCTCAACAGTCTATTGGAGCCAGTTCAGCCAAATTAGGTATGCAGTCTTTTATGATGCACAACAGGTTTTCAAAAAATGGTTCCGCCTTCGCATGCAGATGAAGTG TGAACCGAACTTCCATCTCATAAAGATGAATATTTACAAATTTGAGTTCGATCTGAATTCCTCTTTTCAGTAGGTGGAATTTATGATGTTTGATCTTCAGTTTCGAAGGGAACTACGTAGTTGAGATCCAAATACCTATTCTGGTAATATAAATTCACATACACCCTTCCGTAGCCCCATTTGATAAACCCAATAGATAGATATAATACATAATGCCGATCGCCCGATCTTGCCACTCGTCAACTCACCTGTTTGATAGGTATAAGACTGATCGACGGCGTTATGTGGTTCTCGTGGTGGTGATGGTGGTGGTGATGGTGATGCGGATGCTGGTGATGGCTCTTCAGGCCGCCACTCAGACTGCTGGCTGTGGTGCTGGATGTGATGGGCGTGGCCTTTGTGTTGCAATCCATTGGCAACTCCACCGGGGATTGCATGATGAGGGCTCGATCTTTCACCTTATCGCCATTGGACTCGGCATTTCCATTGCTAATGGAGTTGCAGTTGTTGCTCGCTCCATTTATATTGTTATTGTTGTTGGTAGCGCAGTTGTTGTTATTATTGTTGTTGTTGTTGCCCTGTAATGCAGATTCACGCCAAACGCAAATCAGCTAGTTTATCATTTGTAAGCGAGGGGGCTTGAAAAAGGGATGGGCTGCCATACAGCGATTGACTTACATTAAACAACTCCGTGTTGCCACTCTCGCCCAGCGTCGAGATCTCCACGTGGGGCGTGAGGAAGTGCATGGGGGGCGTGGCATTCTCCAGGGATCGCATGGACTCGCCGCTATCGCTAGCCGGAGGAGCCACCTGTTGCTGCTGCTGCTGCTGGGACTGAGATTGCACGGGCACCGGACTAAGTCCAGGTGGCACGTAACTAGCTGCCGCCGCTGCTGCCGCCGCCGAAGCCTGTGATTCCAGGGCCAGGAGCAACGAAGAGGTGCCACCCGGTCCCGGGTTATCCAGATCGATGCCGTGAC


Search Again