CR01313

CRIMIC CR01313

Gene CalpA

CG7563

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 long band OK83262

Images

Construct Sequences

sgRNA sequence
CTTTGGCAGCGCATTATCCTTGG

Amplicon 5' Amplicon 3'
TGTTTGGGTTTCGCCGTAGAATTACCAATGTTCGCAAATACAATAACAGATGGGTCAGCCAATCTAGCATATTTCGCCCCAATTAAAGGCCAATTTACTATTGTCACAGAAATATATACCCTATATGTGTCGTACATATGTAGTAGTTCCATGGGTCAATGTCAATATCCCGGCTTAATATGGATAAAAAACGAAGCTTAATCTCCCGAATGGCGCACACCCTTTGAGTCACTAGAGAATCTCATGCTTCCGAATGATGTCACACAATATAGCATATATATATAGCGGCTACATATGTATAAATACAGCATTGTATATGTAGAAACATTTGAATTATATTTGGGTGCGAACCGAGACATTCTTGTCTCCAAAGTATAATTTCAGTTTGCGTGAATTAAAGTAATTTCATTTAGCCCGACTTCCAGTCACACTGGGAATACTAACGATTCTGTAATGCTCGTTAAACCATATTTATGTCTCTGGGTGTGCTTTTAATTCCACCGCGAGGCTTATAAGTAAATATGGGCGATATAAAAAATATTGGATGTTGCTAACTAGTCATCAAATGTTTGAACAATAAATATTTATTAATGGGTTTTTAATCTGAGGCGGCACCTTACACTGCTAACTGATATTAAACTATATATGTACATATATTTTCAGATATCTGCACGATGGACGACTTGAGGGGATTCTTGAGGCAAGCGGGACAGGAGTTCCTCAATGCAGCTGGTGAGGCTGCAATGGGAGCGGCCAAGGATGTGGTCGGATCGGTGATCAACGAGATCTTCATCAAGAAGGAGGCCGACACCAAGAGGGTTCTGCCCAGCATCAAGAATATGAGAGTTGTAAGTTGACCCACACGGTTATCAACAGTTATTTATAGGGCGCTATACTATACTAAACAAACATAGAAAACAATCCATTGAAATCTACATATGCATGTTAACAAATACATATACATTCCACTCATTAGCAACCATTGCAATCTCAAAGTAATAGTACGTTGTACTATGGGAACGTAAGTACCTACTCCCGTCATCGTAATGGCATT GCTGCCAAAGTGTCGTACTGTGTTGTCCTTGTGTTCTTTTTCTTTCGCATGTAAAGTGTAAAACGCATCATCGTTTATACAACTCCATTACACAACTTTATCGTGTACATACATAATACTCTTAATCAAGTTCATCAATTTTGTTAGATTCATATCACTAATAGCATGTATTTTTTAGCTGGGAGAGAAGAGCTCGAGCCTGGGACCCTATTCCGAGGTGCAGGACTATGAGACAATATTGAACAGCTGCCTGGCCAGTGGTTCCCTTTTCGAAGATCCACTTTTTCCGGCTTCGAACGAGTCTCTTCAGTTTTCCCGGCGTCCAGATCGTCACATCGAATGGCTGAGACCTCATGTAAGTTTTAGATACTACCATATTACCCGTAACTAAAGGTATAAATGCTTTAATTATAAAGGAAATTGCCGAGAATCCCCAGTTTTTTGTGGAGGGTTATTCGCGTTTTGATGTTCAGCAAGGCGAGCTTGGTGACTGGTAAGAACAAAATCTCTATTTCCGCAGCCAGAATAATTAATAGTTTTAAATAAATGCTTACATTTACAGTTGGCTCTTGGCTGCCACAGCCAATTTAACTCAGGAATCCAACCTTTTCTTTCGGGTAATTCCAGCGGAACAGAGTTTCGAGGAGAACTATGCTGGTATCTTCCATTTCCGCTTTTGGCAGTATGGTAAATTATTTATTAAAAAAATTATTCATGCGCTTCTTACAATTTTAGTTTAAAATTTTAAGGTAAATGGGTTGATGTAATCATTGATGACCGTTTGCCCACTTATAATGGAGAGCTGATGTACATGCACTCCACGGAGAAGAACGAGTTCTGGAGCGCCCTGCTGGAGAAGGCTTATGCCAAGTAGGACTACATTATTCACATACTTTATGGTCAACTGATGTATATATGCTTTCTAGACTTCATGGATCCTACGAGGCACTAAAGGGAGGCAGCACTTGCGAGGCCATGGAGGACTTTACTGGCGGCGTATCCGAGTGGTACGATTTAAAAGAAGCACCCGGCAATCTATTCACCATTCTGCAAAAAGCAGCTGAACGCAATTCCATGATGGGATGCTCGATTGAGCCTGATCCAAATGTCACGGAGGCAGAAACTC


Search Again