CR01310

CRIMIC CR01310

Gene Slik

CG4527

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK83260

Images

Construct Sequences

sgRNA sequence
TCGCGCGGTGCGATTTGGTTGGG

Amplicon 5' Amplicon 3'
AGAGTCATCGTCCAGGTCGAGCTGGAGCGCCGAGTTGCGGGGTTCCTGAGAAAGATTAAATACAGCTTATTAGCATATTCATACGTAGTGTCGTTCCTAAATAATTCCTGTTCGGCTAGCAGATCTACTTGTCTCTTACTACAATAGCGTTAGCAATCCTACGGCCAAACTATGCTTACATTCGGCATGCCGAATAAGCATAATATTCGATTCTGAAATTCCACCGAGATTCATTTTATTGCCATACCCCAAAACAGCCCTAAAAGAATTTGTTTACATCCGACGTTGAGCAATAAACGCATTGTTCGCAAATTCTATCTGTTATTGCTCCATAAACAATATCTAAGTCTTAACGTAAGGAGCTTATAGATAGTGAAACTGACACTTTTGTCAGCTATGTGCTGGTCAGACTGATTAGTAACTTAAAACCGTGTGTGATTGAAAGTGTGCTGCCTATAATTACCGCAAGAAACCGATAGCGAGGGCTTACGGAGGAAGCCAAGTACAATAACAAACACAACGAGCGAAGTATGCCTCCGACAGAGGAGCTAAGTGATAAGCGGCATTTGGCAATGCTGATAAAATAAGTAAACTAATTGTGGGTCCGCTTTTGAAGGACAGTGCCTGGGATGCAGAAACAGAGGAGGGGAGGGGTGCGGGTGCCAGGAACGGACGGAGCACGGACGGCTTGCTGTAGAACGACTTACCAACCCTCTGATAGAGCGAGCGCCGCTTCACTTGGCGTTTAAGCTTCTATATCAATTATTTCCAAGTAACCACATACAAATGATAAGAACAAACATTGCGACATTTTGGCGGAACAAAACAGAACGTAACATAAACGCAAGGCAAAGAATAGTCGAGAAGAAACGAAGATAAACATATAAAATAATGTATCGCGCGGTGC CGGCAGCGTGTAAGAGAGAAGAAAGAGCAGTTGGAGAGGTGAGAGAACGTAGAAATTATCATCACATCTAGCAGTTGGACTACAAGGGTGCGGTGCTGGGCACAGGGATCCATGGGCTTCCAAGGCGCACTCACCTCGGTCTCATCATCCACCACCTCTTCCACGACCTCGGCCTTGTACTCAAGCAGCAGATCCTTGATAGGCTTGGCATCCAGATTTCTGTTGATGAAAGCGTGCTGCATCAGCACATCCGTCGTGGGCCTCACCTGCGGATCCTGTTCAGAAGGAATACAAAAGTAAAGTTAGAATGGAATGTAAATAACAGATTTTAGGGTTACCCACTTTGACTAAGGACTTCTTCAGGAAGTCGTTAAACTCCTTGCTCCATCGAGAAGGCTGCTCCAGCTTGGGCGGCTCGCTCTTTTGTATTTTCAAGAGCACTCGCATGGGCGACATCTCGCTGTTGGGCGGCTCCATCTGCGCCAGCTCAATGAGCGTGATGCCCAGTGACCAGATGTCCACTTTGTGATCGTACGGGTTGTCCCGGAAAGTTTCGCAAAGCACCAGCTCCGGGGCCATCCAGTAGGGAGTGCCAATGAAGGTGTCGTGCTTTTGCATGGTGTGCTTGTTTTTGGCCGAAACGCCAAAGTCCGCTGAAATGAGTTGATTTCACTTTGAGATCGTCTCGGCTTAGGAAAAGGGCACCGATAACTTACCCAACTTGACGCCACCTTCCATTGTGAGAAGCACGTTTCCTGCCTTCAAATCACGATGGATGACTTTGTTGCGATGCAGGAAGGTGAGACCCTCGGTCATGTGCTTGCAAACATAGGCAATCTGCGGCTCAGTCAGCGGCTTTTCCAGCTCCACCATAATGCTATCCAGGGCCCCTCCGTCGCAGTACTCGATGAGCA


Search Again