CR01309

CRIMIC CR01309

Gene CG33199

CG33199

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 long band OK83259

Images

Construct Sequences

sgRNA sequence
GTGGTGGTCCTTGGTTTGCCCGG

Amplicon 5' Amplicon 3'
ATGCCAGCCTATTACGTCCGTGGTGTCGTAAGTTTCGCTTCTGTGGTGGTTTCCAAATGCTCGATCAAGTGCATTACATCCTGTGTGCGAATGCCCCCCCTGCTGGTGGTTCCCTTGGCCAGTCGCTTAGGGCGTCTCCCTACGCCACGTAGCGCGGGTTTGGCTTCTGTGGAATGGCGTTTAATGGCGTCTAGAAACAAGCCGTTCATTCCCGTGTTTAACTCCGGAACACTGATAATAATATTGACGGCAGGCGGCGTTGACGGTGGTGACTGACCTTGCGGCTGGGTGGTTGCTTTCTTGGGCGGACTGCTGAAGGGAGACCCCTTAGATTTGATGCTAGGAGACATCCTCACACTTGCCTTCACACAAGCGGGTAGTAATGGTATTTCAGCTTTGCCTTGCCAGCTTTGGGACGTAGCTCCCTTCAGATGAGCCACATGTTCCTTGGCTTTGGTGTCCTCAGTTTGTACTGCTTTTGCCTTGGGCGGACTTATTAATCTGTCGGGTAAGACGACAGTTGAAGGTACTCCCAGCTCTGATTTCAATGCTTGTGGGGGTTCCTTGCATACGGTACTGTTCTCCTCCAGAAAGCTTAAGTCGGGAAGCTCCAGTTGTGGGCAGGGTTTTTCCTCTGAAGGCGAGTGCAGATTTGGCATGGAACTGGAACTCACATTTGTCTTAAGGGGGGTTTCTGTGGCAGAAGTCAATTGCTGCAGCAGTTCCAATATAAATTCGTCATCATTTGGAGGAGGTTTGGACGTTAAGGCCGCAGGGTGAGAAGGTAGCGTAGCAGCAGGAGATTCAAAAAGTTCAGATTGTGGAGCAGTGATGGGAAGTGCTGCCTCCGAGTTCAGATCTTCATCAGAGGAGACCTCATCGTTGTGTGGCCACAAACAGCTCCTGGACTCGCACTTCAGCAGCTGCTCCTCGAGATTAATGTAAAAGTAGCGCAGCTTGTGATTCCTGCCTTCACTCTGGCACTCCAGACACTCGTCTCCCGGCTGCAGTCGCTGCATTCTCAACGACGATTGTGGTGGT ACTCAGAGGTTTCCCCCAGAATGCGCATGCTGTTTCTGCCGTTTGGCTGCCTGGTTTAATGTGCGTGTGCTCACCTGACCGAAGGTTAAACGGAAAGCGTACAGGCCGAGATTGCTTGTTTTCATGGTCCGTTCCAGTTCCAAATCGAGCAAATCGGGACCTGCAACAGTAGTAGACACGGTATCCGGTTATTCGAGCTTACATAACATCAATTGATTTTTCCCCGACTGCGTGCGCTTTGCTCTTGTTCGCTCATTGCTGGCGTTCTTTATCACTTACGTTTCGTTTGGCAATGGGAACTTTAGTGCTCGGCGCTCTCTGATTAACCGCGATTGCAGGTGCAGCCGATTAAACCAGCAACGTTGCTAAAATTTGGCGAGCAAATGAAAACCAAGAAAACTAAACGATCTAGAACTCATGTGAGTAGCGGGCAAGTGCGAAAGGGACTCGAGATTAGAGATGGGACTTCGAGTGGCTGCGATAGTATCGATCTACGGAGCACTTGCCTGCTGCGAGAGATAGCAGGGGTATTTTTTATTTTTATGCTTCATATTGTTAAGAAATCAACGAAAACTTTGAGCGTTAAAAAGAAGTTTCCTTACTTCAAATTCTTGTTGCATTTCCAACGCTTTCAGAATTTGAAACTTTGGAAATGTAACATCTTTAAAGTTGATGGGAGTACACATGCAAAAATATTGCGGGATCATTAAAAATACGAAAAGGTATTTTTCAGACCAAGCACACTTTTTTCTTTTCATGATATGTGTCCAATAGACAACTTGTCGGTGAAATGGTAGTTAAAAACCTTTATAGTGGAAAATATAAATTAAAGAATATCAGATTAAAACCCAAAGGGCAAAACGGTGTGA


Search Again