CR01305

CRIMIC CR01305

Gene Tsp42Ef

CG12845

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK81216

Images

Construct Sequences

sgRNA sequence
AATTGACGTAATCGCTGGAGTGG

Amplicon 5' Amplicon 3'
TGACCTAACCGCAGTGAGTGTTTTTTCCACTCTTTCATTGGTATTCATAAATTAAAGTATTAAGTATCAAAGTTTAAAGTATTATTCATAAATTTTAATTTTAAATTTGACTATTCACATTATATTTCACATATTATTCTTCCTACGTTTAAAACTGATTGTTTTGAGATTATACGTTTATTTTATGAATAGCGATTGTATTGAATGCTAGTAATGATTATATCTTCATTTTTAGCAAACATTAAACTAGTTTAAAACAGACATTGCCCATATTTTAAAAGCCACTTCTGGGACCCGCCACTCAGCTTTTCTTGTCAGCCTGGCAACGTTGATGTCATTCGGCACGCAAAAGCTACTTCGAAAGCTTCGGAGAAGAGATAGAGATAGCCGGCAGTAGAAGCGCCGTTCAGTGAATTTCTAGCCGACGGACAGACCGCACCTGATCCGAGTCATTCGCCCATGAGTCATTCAACTCGCTGCGGGAAAGTGCCTCGCTGATTCCGACAATTTCCCACCATTGGTGGTGCTACGTTGCACGCTGTTAGATTGAGGAAATTCGACATAGTTGCGACGATCTTCCAGAAAGTATCGATAACGTACAGGGAGCCCAGAGAGAGATAGAGAGATATAGAAACATCGCTGATCTCACTGATCCGATTCGATCTCAAAGAGAGCGGAGGAGTACGAAAACAAGTTTCGCGCAGCTTGCTCTCTCTTCAGGCGGCTCTCCAGGAATTTCAGGCATCTCGACCCCCAACGAATCCGAGGAGCATCATCCGCCATGGCGTCCACGTCGAGTGTGAAGCTGATTGTTTACGCCCTGGACGTACTTTGCACAGTGAGTTACTTTCGCTAGTTTCCCGCCCACACCCGAGATAGCCCACT CAGCGATTACGTCAATTGTATGCGTTGTAAACAAGAATACGGTACAACGACCACTTAAGTTGGTTTCGCAACGATCCCAAACAATGCACGAAATATATCATCTTATCAAATGGCACAACTTTAAGTGTACCTGCGTACATATATACACGGCATATTTTAGTATGGGAACCGTCGCCATGTGTTAATTTTTGGTTGGCAGGAGTGTAAAACACACCAGTAAAACCGTCTAATGGTCGAACCCAATTCCCCGATTATAGTTTATTGGTTTATTTATACAATTTAATTGCAAGCCGCGGTGAGAAGGACCAGATGGCCCCAGAGGTCACAGCATATATAATACGATCGGGCTATCCGTCCGCTGGCAGCTCATCAATTCGAAATTTTCCAATCGATATCTGGACTTGCAGCAGGGACTCGGCTTACTCATGACTTTCGGACGAATCCATTGCAATCGGAAAACAGTCACACTCGTATCAGAGCTAAATCGAAACAGCTAGCGAATTAATCACCGATGTTTGCACCTCGCCTTTCATTTTCGAATCGAAACATCATCGCTGTATGAGCGCCTCACGTCACCTTTTAAACTTATCCCAATGCTACAGAGACTGAATTTGAATAATTCAAACCCACTCAAACAAGCGCGTTAGCAAACAAGCTATCCGCTGCGATACCGCCGTATCAGATATGAATAGTAATCGAGTGACCTTGTCTGTGTGCGCAGTCCTGTCCGAATTGTTTGCTGTGGGTGTCCTTCTTCGACTTCCCAGTCCCTAGTTTCCCACACCACGTTCCCGCCAACTTCCTTGGCGTCTATCCCTGTCGCCAGATGGGCTAGCCTGGAGGACGCCCCCGAATGGGCTCTCCAACTAACGCCTTGTGCGAGGTCAAAACACTAGAAATGGAACACTAGGCCACAAGTACCAGGACTTTAGTTAAATGGGTTGCTGACGAAGGTAACTATTGCCAATTCAGTGAGTTTCACTCGCAAGGAAAGATAAGCTGAATAACATAACAAACACTATACAATAACAACATGTCTATGAATGTGTATTGCCGGCCAATTTGAATTTGGACGGCTTGATTGTGGGATTTCAGCGGTCTCTTATCAAAGCTATCAAAGCTATCAAAGCTGTCGAGCGCCACCCTTATAA


Search Again