CR01304

CRIMIC CR01304

Gene CG31712

CG31712

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK81215

Images

Construct Sequences

sgRNA sequence
CGCAGCATGAGTGTCCATCCCGG

Amplicon 5' Amplicon 3'
ACACCATACCACTTCGCTGGGCTTTGGTATTTCTTTGATTCTTTTGATATTTATTGTTTGGTGTGGAGGAAATGCGTCCGTGGACCAATCGCTCGGCAGCAGGCTTGCTCAACTTCCGGCATGGCGGCACAACGTGGAGTGCACGCGAGTGTTTTGCGGGTAAGGATCACAAAACAGCCACACACACCCACTTGCATACGGGACAAGAGCAGCACGTTCGTTGCACGGGCCTACTGAAGCGGAATTTGCGCGCAATAACAACAACAACGAGTTACGAGAACCAATACCAAAAAAATTAAAATGATACAGTATGTGGGTAGGAACGAACAAAAGATGAAGCTAAGAGTATGCAATAAGTCTGCAATAATGGGCATCAAAACTTTGACACATGCGACACTTGGCAATGTCGTCATTTTGGCTTTTTTGGTAGGAAAAATAAAAAGTTACAAAATTATTGGCAAGAAGAAAAAAAGGGGCAAAACGAGCCGTGGCGTTCTCATCTCGGCTCACAGCATTTAGCTTGCTGCATCATGTGGGGAGGGCTCTGAAAAGTTGCGACTGGTTAGTGATGTACCCGGTTAGTGGGCGCCCTTGGCCCAGGGTTATGCAAGCAATCTAGTACGGGGAGGCTGCTGATGGGACATGGGTTGATGGATGAACAGCCAGTGAGCCGCGACTGAGAGCGCCGCCGGATCGATTTCGCGTGACGTGGTGGAGACGACTGTTTGAACTGCTGTTTTGGATTTATTCAAGTGTACGGTAAATGTGGCATTGTGTACGTGTTTCTGACAGTGATAGCAGCAGTCGTCCAGCGGAATCTGAATACGAGCACCTACCTCGCGCCGGCGTTCTTCTTCGCGTATCTGCTCTCGCCGCCGCTCCAGCTCCAGCATCATTTCGCGCTCCATCTCAGCCTTGGCGGTCTCAACGCGTCGATTGACCTCCTGTTCGATTTCGTCGCGACGCTTTTCTAGCTCCTCCTCGACGCGCTTTTTTACCAGCATCTCTATGCGCTTGGCGGCTTCCTCTTCGATTGTCTTTTGCTCGAGCTCCTTCGCCCGACGCTGCCGCTCCATCTCGGCCAGGCGTTCGACCTGCATCTGGTTTTGCTGTAATGGTAGATCATAGTTTAGTTGCTTTCATCGAAACAGTTGTATCATAAGCGCAGCATGAGTG TGGAATGCGTACCCATGGAGTGCTCAAGATGACAGACTATGGACACTATCCACTTACCTCATCCAGCTTCTTAAAGCGGCTGCGCTTCTGTTTGCTACGTTGCGACTCCTGCTCGGAGTACTGACTGTCGCTGCTCGACGAGCTGGAGCGTTTTCGGGATTTCAGGATCGAGGGGGAGTGACGGTAGTCGCGCTCAGTGTGTCGGTCGCTGCGGTGTCTATCCCGCTCGCGGTCCCTGTCCCGTTCGCGATGTCGTCCATGGTTGTTCACCTCCGAGGACTTGTCTCTATCCGTTCTTGTGCTGGGCCGCTCGTGGTCGTGGTGGGACTTACTGCGTTTTTTGTGCTTGCTCTTATGGTGGCGTCGCTTGCCCGACGGACTGGGTGTACGTGAACGGGAGCCCATGGTGCTGGATTGTGTGATTGTATAAGATTTCGAGCTAGTCGAAGGGCTTAACTTGGCTGCCACAACAAATCAATGAGAGCGAATTTAATTTCTCGAGCAATTTTCACAGATGCCTTAAAACAGTGTGCACAACGTTGGCATACTGGCCTGACATAATTCTGGTATTTTTTTTGATACGGTATTTTCTGTGCTTTTTTTATTTTAATTTCTGTGTTGCCCAACATTAGACCGGCAATTGTTTTCAGTTCACATTGGTTTGTTTTGATCTAAAATCATTTGGTGGAACTTGTCGATCATGACTTGGTTATCCTTAAAGCCGACGCACTGCTTGGCCTCCTCCTTGGGCAGCCACTTGAGGTCGGTGTGCTCCTCGGAGAGAATGGGCTCCTGGCAGGGATTCCGCAGCTCCGCTAGCCAGTAAATAACAATCTTCGGCTTGTCTTGCACCTGATAATTCAGGGTCAGCGGAGTGTCCTTGTATATGATCAGATCCTTCTCGTCGTACCTATGAGAGCATTTTTGAAATTAAGCATGTTTTAAAAGATATATCGTTGTGCACTTTCCCGGCTTCCTCTTTCGTTTCTCGCAGGGCAGTGGTAAAATCATCCTCGCCTGGGTCCACATGTCCCTTGGGAGAACTCCAGTGGAAGGAGCCGTAGGAAG


Search Again