CR01302

CRIMIC CR01302

Gene vkg

CG16858

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GATGGCAAACACGTGAGCGATGG

Amplicon 5' Amplicon 3'
CCCCTCACCGATCACTTGAGCTGCTGCTAATTGTCGGAATCGAACTGCGCACACACACACAAGCGCACTGGCGAAAGAGCACACTTATTCACAGGCAATAACGGCATTTCCATATATGTATTTATAGCTGGGCAAGTGCAGGAGAAAAGAGAAAGGGTGCATGGGGTAGTGGTGCAGTGGTAAAGTGGGGAGAGCGACTGATAAAGACCATTTATCAAAATTCATTCATTGAAAGCCTCAGCTGCATCTGCAATCGATGAGTTCATCTCTCTCTGTCTCTTCTGCTCTTCGATTGAAGCGGCTCTTAAGCGATCGGCTCTCTTTTCGCGGAACGGAAAAGGAAATCATTTGTTCGGCTAATGAAGCGCCAAACTGGTTGCAAAACCCATTGCGAGAACAGTTTTAGAGCCATTGCCTGAGAGCTGTTAACTGTTTAATAAGTATATTCAAATGATGCTGGAATAAATACCCTTAAAAACATTAAGTATGAATATATCTTACTCATAGCAGATAATTCCCTTTATAAATTTCTTTATAGATTGTAAATAATGGCATACATACAATGTGTGTTTCTAATCAAAACTAATTCCAGCGAAAAATGTGAATCCCCTTCTATTCAGATTAGCTTAATGCACCCAGGATATAATTAATTATATCGTTTTCAAATACTGTTGCAAGTGAAACAACTTTTTTTGTAAGCCTTCGCTTATCGTGAGGGTAACACGAGCAACGGTAGCTAAGCGAAGTCAAGTTTTTCATCGTTTTGCGGTTAGTCCTCCATTGGCAACCCACAAGACCTGGAGACCTGGCAGCTCTCACTCGGAATCCGGGAGTTAGGGTCCCAAGCCCATGGCATTGACCACGTAACCGAGTGCGAAAAGAGCTGTGGATCGGATTACCAAAGTCGTCAGACGAGCTGCACACTT GGGCCAGATTTCCAGATCCCAACGAATTGAGTGCACGAATTGTGCATTGAGTTAACTGCTCAACTGGTATGAAAACTAAACTCTGATCTCTGGTAAAGGCAATAAAGTCAAGCCAAGCCGATAGCCTCTGCGACTGCTGGCGACACTTGTTTCAATTCTAAAGTGTATTTATTCTAAATTCGAGTCTAGAAAGCCATGTCGCAATCAGCGGAACATGCTATCAATGGCGTCAATGCCGCCAACATAGCAATAGGTCTAATTAAATGTGTGTAGATCAGTCGCAGCCTGATAAGACCAGCCGAATGCCATCAAAAAGTAGGTGCCGCCGGCATGTGCTCCATTTTTCATCCAGCATTACGAAATCTCTGTGATCCCTAGCCATTTAAATATTAATACTCAATTTAATTTGGTACATACACAAGGTACACTGAATTGGGCAACTCGGTGTTAAAAAGTAGTGCATAGTTTTTGGGGCAACATTGAGTATTGCGTTTGCCTCGCACTTTTGTGTCAAATCATTTTTGTGTTTGCTTAAAAAATCATTCATAAATAAATGAAATATTCGCAACCTCAATGGTTAATGTGTCTTATTTTGAATAATAATCTATTCAATTGGGGTAATAACTAAGAACCTGCGCATTCTTTGTTTTTCATACTCATTCCCGTTTCATTTTACAAATGATTATATGCCAATTAAGCGACTAATCTGGCGGTTATTAAATATAATTCTAATTGCCAGCCGGAAACGTTCAATGGCGAACCACAATTGGTATGCCAAAAAAGCAATGTCCTCCAAATTGAAAGATTAGGGGGGTTATCAATGGGCGTTATCGCCAACCTCTTCACCTACAAAATTATGTTGCCAAAATTATTTAATGACATAATCGATCCCAAGCTGGACTTGGACTTCATTGAACCCCCG


Search Again