CR01203

CRIMIC CR01203

Gene Hcs

CG14670

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GGGTGACGCCGCAATGTGGACGG

Amplicon 5' Amplicon 3'
GGAGCCAATTACGAAACCGCCATTGATTTTGGTTCCCATCAATATGTAAGTTGTGCCCCGGCTTCTGAATTAGTCCCCAAAAAACTTTGAGTCCGCGGAGGAAGCAGTACCCACCAGAAATCTGCGATGTTGACCCTGTATTACGTGAGTGCCACCGTCCTGCAGTCCTGGCGCATTCAAAAGGCGTGCTCCAAGATCGCCGAGCACCTCGCGCAGCCCTCGAGCATCGCCTTCTATACCCTCCAATCGGGCAGCGATGACGGATTCGGTAAGTGGCGGCGTCATTGGAAGGCGTTCACGCTTATATAGACTGCCTGCTTCCTCCACAGATCCCGCCCTGGCCAGCTCGGAGTTGTGCTGCAATCGGAACGCGGCCAAGGTCACGGACATCCTGTGGCTGCACGCCAACCAGCGGGGTTGCTGCCTGCGTCCGCTGCAAACGCTACACATCACGCCTTGGATCAGCTTTCCGCCGGCGCCCAGTCTGCTTCCCTTCTCCTATGCCGCCGACACGTTAACGCCGGCGTCCACGCCCACGGAGGCGGACGTCCCGCGCCAACAACGGGTTTCGCTCTCTGCCCAAGGGGAGGAGCGGATGCAGCTGCTCCTTGAGGCCGACATAGAGCCACTACAGCGGCCCAGCTCCGAGGACACATCAGCAGTACGGGTAAGTTAACCCGACGGCGTGTTGCGTTTTTTTTAATCTCCAAATCCATCAATAAAAAACAGTAAGGCTTAAGCAAATTCAAGTTATAAATGTTTAATTGCCACAATTCGGAGTCCACAAATACATGTTTATACATGTTTATTTGCAACAGAATAGTTCAAAGACTTCAGGATGTAGGAATAGCTTTTTAATGGACTTTTAACTACATAGTTTGGAATTCACCATTAAAGGGGGACTACGAATATTACTCCAAAGTATCTTAAGAATGCTACCGTAATTAAAGTTAGCCCACTTTGTATCATCATAATGAGAACAGATAGGGACAATCGACCTTCGGGTGACGCCGCAATGTG GTGTTGCGTGCGGTAATCTTATTAAGATGTACATGGTTGAATCGATTAGAGCGCTGGCGTCATACATACATACATACGACTACACTAACTAGGGGTATCCTCTCGTGTGTCCTTTCTTCTTCTTGCATGTCGGCGGCCCATGAATCAGCTGGAAGATTACGGTAAGCTAATTGCTTGGAAAATAGATTCCCACCTGGCGGTGCTCATCGAAACAGACGTCGAGCACTTCACGAAACTTTTGATAACGACTTTCTTGAGAAATAATTTATGCATTAACGATCAGCTGCCACTTTTGCGGATTGAGTGTAAGCTGCACCTGAAATCGTTTTAAGAATTTGACTTCATCTTAAAAATCCCACTGATTTATTGTTTCTCCCTCCCAGCGGTGCAACGGGAAGGGGATCCGCAGCCCTTTGAGCTTCTGGCCAAGCATCTGAAGCGGCAATCCCGCATAAGCGTCGGTCTGGACAAGGATGGATGGAAGAAGCACATGGAGGACTTGCGTGCCGTAGGTGTGCTGGCGCACCAGGCCACCGAGTTCGAGTACCAGAGGAATCGCTCTGAGGGAAGAACGAAATCGGATCCCACCACACATGATCAACGCCCGACTTCGGAGCTTTTGGCCAAGGCTGTGGCCGTGGTGGAGCCCACCAACAAGGCATATCTGTCTCCGGCAAGGACGACAGAAGCCTCGCTCAAAGCCGAGGCCAAGGGAACGTCAACAAAACCTTTTCCGACTAAAAGCGATGCCAAACCCGCCACTCTTGCCAAGAGCGAGGGCACGCCAGCCACAAGCAAAGAGGACTCCAAGTTAACGCCAACTAAGGGTGCATTAAAGACAAGCGAACTAGAGAAACTAGCGGCTGTCCA


Search Again