CR01199

CRIMIC CR01199

Gene Pura

CG33275

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band no bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGGGAGTCGGACTTATTGGGGGG

Amplicon 5' Amplicon 3'
GCCAAAAACAGAAGAGCCCGGTGCCGGTAAATTGGCAGCCGAAATAGCCAACTATGTGAGTCAGCAGAGCAACTGGCTTCATTCGGGTACAGTAATATAGCAATCGAATCGGCTCTATTAATAGTTCACAGTTCAGTTGATCAGCCCACATGTCCTCTTATCGGCATCGGTTAGCAGTGAAAATCGACTTGGGGCCGAGTTTTACTAAATCAATTAATTAATTTATGGCCAGCCTGGGCGGCGGGGCAATCGTTGAGAAACAATCTGCCGATCGGCTTTATGGAGCCAAAAAGGCCAAACTGCCTTCCCCCGTCTATCGATCGGTTTCAATGTAAACAATTTTCAGCAAGCCGGCTCTCCATCTTCGAAATACAGGGTGTCTGCAGTTCTTCAGACTAAATGTTATTCATTATACAGATAAAGTGCACTCAAAACCATTCAAAGTTTTTGTGACCCAATCCAGTTGTTTTGACATACTTGTACTTAATGACATCATCGATTTGTGTGTTCTGTTCTATTTGATTGGAAATAGTTGAGCCACAAAATGGAATAATTCAAGGTTCGATTTCAATGTCCGGCTTAATTATTTTTCGTCTCTGTGTTCACTGGTCATAAACACACTAGTGTGGCAATTAAATATTTCAATGGGGCATTTTCCGAAATCTTTTGTTTCCTCTAAAGCTCAAGCTTAGCAAAATAGAAACCTGTGATTCAACTAAGCGTTTTCGATTGTTTCCGCCCAAATGTGAGTCTATCCTTAATTTCTTTGCATATTATGCGAATGAATGCTATGAATAAGTTTGAATACTTTTCTCCGTAAGTGTCCGGTATTTCCAGTTAATTTTTCAAAGCACCTCTTGAGAAACTTGAAAAACTGATAGTGTGTGGACCAATGAGTGCAATTATCAATCTGCCATGCTAACTCGAATGGCCAAAAGCACTCAGTTCCGAAATTAGATTAATTAAAGAACGAAGTCAATTAAGAAATCAAGCCGATTGCCTCACCCTGTACAAGGCTTAGATCTATATGTATGTATGTATATATACGTTAAAAGCCGTGCCTGCCATATCTGATGAGCATGAAGAGTCAGCGCCTCTGACAGCCGATTGTGCTGCGACTGTGAAACTGGAGCAGCTGTTTCGAGCCCCTG TAAGTCCGACTCCCACTCCACAGCCCCTTGGGACTTTATTTTCATTCATTGGGTGGATTGCAGACGTGGACATGGCCCAAAAGTGGCTCGAGATAGTGGATCTCTAGGCTAGAGAGATGGCACTTGGAAAAAAACAGGCGATCATATTGCACTTTGTGTAAATAAATCGATTCTGAAAATATGATAAAATTGAGTTCAGCATCCATCTTATCAATGACCGTACACTACAATTTCCCAAGTATAATCAATATTTTGAAGATATTTAGAAATAGTTGCGTTATTAAGATTACAGGAATGACTATGTTTTTTTCTCAGTGCAGAACTAGAGTTTGGGCAGAATCCAAAAACGGAAAGTGAATGCGCTGGTGCACGCGTCGCGACCTGGGATTTGGGATTTTGGAATCGAAGTCGGACGTCGTCGGATGGGCGCTTTCTGGGATGGGATGGGATGGGTATGGAAGCTGGTTAGCTCGGTTCCGTAGCAGCTACATCATCATCATCAGCAGCAGCGATTGTATCAATTCAATTGGACGCAGCAGGTGATTAAAAATTGGTTAGAGCCACAAAATTATCAATGTGAGATCGTTGATTGCCCGTGGCTGTTGTTTTTGTTTGGACGGCTTGTCTACCTGTGTGGCTGGTTGGCAATGCCTTTGGGAGGCTTAGCTACCTCCAAAATACCCATAGTTGAGTCGTTTTATTTGATTTGTGTTCGATTGGATTTTAATTTGTAAAGTGGAGGCTAATTAGAGCGACGATCATTTCTATGAGTTTCACTTTTCAGCGCTGTGAATGGGGAATTGGAAATTGGGGAGGAGACGTCGATGACGATCATGATTGTGATTATGATGAAGTGGAACATGGCAATGGGGAACCTTGGCCTGGCGCGTGGGCTTGTTTACAGCGAGT


Search Again