CR01194

CRIMIC CR01194

Gene IP3K1

CG4026

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK (weak) OK83257

Images

Construct Sequences

sgRNA sequence
CAGTTATCGCGGCTGCGAACGGG

Amplicon 5' Amplicon 3'
TCACTGTGATGCCATCCACCCCTTTTTCATCCCTTCAGCTCAGTGAAATGGAACGCGTGACGAATTTGTGCCACATGTGCAAATTTGCCGACTTACGTAAAGATCGCTCGCCATTCGGGGCAATGCTATTAGCCCAAGATTACGGGCGTTGGTAGGGAACTGCTTAAGAATACGCAGTGTTATCTGGCCAGTTAAGATACGATAATAGTGGAGAGATAAGCGCAAGAAAACAAGAGCAGAAACAGATAGGCGGCCATATAAGATGGGGGGGCCGAAACAAGTTCCGCGGCATTTACCTTAATTAGTCAATTAATCAACAGCAACGGAGTGAGGATCGTTTCGGTTTGTATCGGATTGGTTTTGATCAGTTCATATTGGCTCGGATCGCCTTCTACGCTGACAGATCGTTATTTGTTATGGCCAATGCTTATGGCTCAATTCGCATAGGCAGCGCAAACAAAAACAAACGCCAACTTTGCATACTAAGTGCCTCATTAGGGACACGGCAGTGCCGGGGATCTCGGTCGTAAACCACACACGACGACCCATCAAGTGGCTCCGCATTTTTATATAAGCATAAACAAAACGGGCCGCCTAGAATTTTTTTTGCCATTTACCCATGCATTCGGCTTGAATAATTAATTAACGCCTTCGTGAGTCACAAAATGCATTGCAATGTTAAATATTTTGTATCACCTTCTTGCACTGACTAACAAATTTATTCATTTCCTTTGTTACAGCGGATACCCAACGAGAACTGCGACTATTTGAGTCTACAGAGATCGGGCCAGGCGCCGAAGAATCACATCCAGGCGCAGGATCCGGCTCAGATGTCCCTGCTCAAGTTCTTGGCCATTGTAAGTACCCCATGTTGTTAGCACACTCGTCTCGTGGCAATTGGCCAGAAACTTTCCACCGTAGCGCTTCCTGGTCAGGAGCCTCGGACAATGTGCGATCGGTTGGCCTGGCGAGCTGCCTGCATAAATTTCACGTTTACGAGGCTGTGAGTTGGGCGTGGCCCGTCGGCTGGCAAATAAAATTCGTTTGATTATTTATAATCGCTGCCGGCGGACAGTAATGTTTCCCTCTGGCGAAAAAGATCGAGGCAAACCCGTT CAGCCGCGATAACTGCAATTTATCAATGAATGCGTATTTCTTGTTATCCTTTACTAAGTTAATTTTTTTCTTCTTTCGCTTTCCAGAATGCCCTAGAGCTGAGTGCCCCAGCAACGCCACATCTCCTCCAGCATCAGCAGGCCCACAAGCAGGCGAAGCCACAGGGCTGGATGCAGCTATCCGGTCACCCAGAGAGGTAAGGATCTTACCAATAACTTAAATTTTGTTTTGAAAACAAACATTTTATTAGTCAATTTACTAACTGCTACTATTATTCTTATTTTGCAGCATTGTTCCCACATCGACTGGAATAGTGCGCAAACGGATCTCAGGACTGGAGGATAGCGAAGTACATGCCTACCGACTGATCTGCAAGGAACCACAGACCGCTCAGATAGTGCCCGCCTACTTTGGAATACAGGAGATGCAATCACAGCACTTTATTGAGCTGCAGGATCTGCTGGCTGGCTTTCGGGATCCGTGTGTGATGGACATCAAGATGGGCAGCCGCACCTTTCTCGAATCGGAGGTCAGCAATGCCACGCTCAGACCGGACCTCTACCAGAAGATGATCGCCGTGGATGCGGGAGCTCCCACGCCTGCGGAGCACGAGGCACGAGCGATCACCAAGCTGCGGTACATGACATTCCGGGAGTCCCTGTCCTCCTCCCACTCCAAGGGTTTCCGGATCGAAGCACTGCGTCTGCGCGGACGACCGCCTGTCAAGGATTTGAAGACGTGCCGAAGCAGCGAGCAGATTGCCCAGACGATCGAACAGTTTCTGGCTGCTCGGCGATCCGTGCAAAAGGAGCTGCTGAAGCGACTAAAGC


Search Again