CR01191

CRIMIC CR01191

Gene Gat

CG1732

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK (weak) short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TTCATCCCTCATCTAGTTGTTGG

Amplicon 5' Amplicon 3'
GCTTGGACACGGGTACTCAACAGACTTAAATATATATTTTAAATGGGTCAGTAAATTGTTAATCATTGTTTTGTGGGGGAAATCACCATTCAAGCGTAAATCTTATTTAATTTAACATCCGGAACTAAATTTGTAACACACCGTGTATTTACACAAACTTACCACTGCGCCTACGACCCCATTGTTAAATTGGGCAATGTCTGAACCCCCTTCTTAAATCATTATTAAATTAAATTGTATGTAAAAACGTCAACTAACCAGCCCCCTTATTTTTAAGCGTCGCTTTTATTATCATCGCTACAATGGGGCAATCTCCGTTTGCGGAACAGAGCATTGTATTAGGTAGCTTAGCTACTCAGTTTAATACCAGCAATTGCCCGGCGAGGGTGCTGTTTTTGTGACTCTGAACTAAGTCAAAAACGAGAGCAAAAGACGCAGTGTTTGATTGTCCTAGACTATCCGTTTGTCGTCCTTAATACTTATTAAAATTTATTGTCGAAATGTACACAAACTCCGCAAGCGATGGTGACGGAGGAGGAGATGTGTGTAAGCACGAATCTATTGAAATGAGTAAAGAATTGGGCCACACAACCAGCTTGCAGTCCAGCTCACCTACAACTACGGACACGTCCAATAAACAGCAGGTTAGTGTATAAATTATAAAGGCGCTCATCCCTAAATACATAATATATTATTATTAATTCTCACCATGTGAAATCTTTAATCACAGTTGGTTTTCTGGAATAATAATAAAAATATCCGCTAATCAAATTGTGATAATGTAATGCTCTTAAAATAAGGTCCGAAGCAGAACCCATACATTAATCAAAATTTTCTTTGTATCGGCTGCTCAATTTTTTTACTTTTTTAATCCCAGATTACGGGGAGGCTTCAAAGAAGCAATTTCACAAAGCTAATCAATAAATTCATCCCTCA TCATCCCTCATCTAGTTGTTGGATTTTTTTTTACATCTTTATTTGTTATATTTCAAAAACCTTATATACGAATCTGACGTCTTAAGCTAAAGACCTCTAACCAAAGATGTCTTCTTGTTGCTTTTGTTTCTCTGGTATTCTATTTATTTTACGACTATTTTGTCATCGTCTTATCATATTATAAGTAAAATATCGTAGTAGATATGTTTCCGACCGTCCACCTTTTTTGATTATATTCTTTAATATCTATCGATATGCCTGAAAAATTATGAAATTTTGCGTTCGCACTTCCACTAGTTAAGAATCGGGTATCTGATAGTCGGAGAACTCAGCTATAGCAATCTCTTTTTTTTTTATAAACAGGTAGTTGTATGTGTACTTCTTACTTGTAGGTTACTGAGTATACTAGATTCGTTAAAAGCTTGTAACTAGTAGAATGAATCGTTTCCCTATAAAGTGTATATATGCTTGATCAGGATCAATAGCCGAGTTGATCTGCCAATGTCCGCCTGTCCATATGAACGTCTCTATCTCAGGAACTATATAAAAGCTAGAATGTTGAAATTAAGCATGCGGATTCTACAGGCATAGTAGGAGCGCAAGTTTTTATACCCGTTACTCGTAGAGTAAAAGGGTATACTACATTCGTTGAAAAGTATGTAACAGGCAAAAGAAGACGTTTCCGACCATAAAAAGTATATATATTCTTGATCAGCACCAATAGCTAAGCCCAACTCGCCATGTTCGTCTGTCGCGCGAAACCGACAAATAATTTGTAAGATATGCTTTTTTCCTAATTATAACAGGCGAAAGAAAGCGTTTCCGACTATATAAAGTATATATATATATATATATATCAGGATCCGTCCGTATGAACGTTGAGATCTCAGGAACTAAAGAAGCTAAGAAGTTGAGATTAAACATACAGTTTCCAGAGACATAGACGCTGCGACCACTCTAACGCCCACAAGCCACCCAAAACTGCCACGCCCACACTTTTGAAAAATTTTTAAATTGTTTTCTCATTCTCACTTCTTGTGGATGTTGAATATAGCATTCTCTCTTGTTTCATTTTAATTTGTCTTACTATTTTATCGGTACACCAAAAACTTAAGTACTTACGTACCTACAAACCAAAAATTTGTAACTTGGCTCTTAGAGTTTTGAGCGGCTTGTGGGTATT


Search Again