CR01188

CRIMIC CR01188

Gene fwe

CG6151

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CATGTGAGCCGCGCGTTAACTGG

Amplicon 5' Amplicon 3'
AAAGCAGAGCGCCAAACTTGACACAGAAAAGCTCCTATACATACTTGCAATTTCCTACACACGAAATAAAAAGTTATCAAACGAAATGGTTAGATAAGAGATATTAAGTGCAGGAAGCCCACTTAGTTAAGTGGGTGAATGTATTATTTTATATTTCAATAACAAAACAAAAAAAAACCTTTTTTGGACTTTGTTTTACCTTAAAATTATACGTTTCATTCTTAATTCATTTGGAAATCTCACACTTTACCCTACATTTCTTTGATTTTGATGTAAAAATAAACTTTAGCTACATACATAACTAGTATTTTTTTCAGTGTGTGAATTTGTGTATCCTTTTTGTGTTGTCTTTTCCATGTTTCCTTTCTCCGCTCTCACTGCCTCTCACCTCTCACTCACCCTCTCTTGTTTTTCCTTTATCAATGTCAGAGAGCGTGCGTACACACACGAACACAACTGCACACCTACACCTACGAATAGATAACAGCAACAACAACAAAGGGTGGTACACAAAAATCGATGCAACATATTTTTGGGCCGCCCAATGTCACGGATGTTTTTCCCAACTTTTTAATGTGTTAAGCTAGTAGATAATTTATTATATATCCTACAACTTACAGAAGGCGGCCACAATGCCCAGCAATCGACTTCCATATTTGAGATACCACGGCTGCTCCGGTCCAATTGGATCTTGTTGATTCGGCCGTGCCAGCAGACCCGTTATCTTTTCCGCAAACGACTGATCCGGGAAATAGACGGAAATAGGGAGAAATCGAAATGCAATTAGGAAAAATCGAAGCACAATTTTGTATTGTGACGCGGCGGCCGCTTTTTTTAACACGCACACATTGCCACGACAAAAACACACACACCAGTTAACGCGC TACACACTGACACCGCTCACTGCGTCAGCATTTTATCTCAGTCAATCAACAACTACCTACCATGGCTATTTATTTAGTTAGTTAGCTAGGCTTAAACTAATTCGAACAATTACTATTTGCACTTTTCACGTCACACGGAACGAAAAAAATCCTGTTGTACTTTGCGTTCTGCTGCACGCGAACCGAACTAGATCGCGATTCTGATGGCCGATAGAGCCTATCGATACTCGGAAGTTATCGGAGGCGAATGGAACTAGTTTCCTGGTATCCTGGATTCACTACAACATTTTTTAATTTTTAAATTTATATTGCAATTAGTCAACTTCTTACTTTTTTCATAATTATTTGTATTTTCTTGTTTTGGGTTTCGAACATTCAAATAATTACACAAATACTTTTTTAGGTAATGAAAAAACTACAGTCTAAACTTGTAAATTGGTTTTTGTTCGATTATGATATTAAACAATATTTTCCGGTTCTCTTAGCAAATGTTAGGCAAATTTGTGTACATTGAAAGCTTTTATACCGTTCAATATGCAGGCGGCATCTTTAGAAAATTCACTTCGATCTCAGATCGTTCACCTAACTCCTAAATCTGAACAACTATCTCTATTCAAATCAATCAAAATTAATTTATTTTTAGATTTGCATAAATTTCTAAGTCCGTAAATTAAAAATCGATTAATTCAATTGCCTATCGACATTAAGCAGCTCTGCATTGTATCGATAAATTAAACATCTATCGATAGTATCGATTAGCAGACATCGAAGAAATCATTGATTACTTGCCTTTTATTAACTTGGTTTTTGGACCTCCTCGAAAATATCAGCAAAATGACAGAAGCGGAAATTTGCAAACTATGCAAGGATAACCGAGCAATTGAGATCGATCTCGAGAAGCCCAAATTCAAATCGGCCAATAAACTGCTGCAAAGACTTTTCGATTGGTACAAAATTGATGTAAGTTCTGAAAGTGAGTCCAATGGATGTCAAATGCAAAGAAACCCACGTATTTTAGGCTGCTATCCTGGGGGAAAATTACTGCATTTGCGAGCCCT


Search Again