CR01184

CRIMIC CR01184

Gene Ir25a

CG15627

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK81212

Images

Construct Sequences

sgRNA sequence
GTCGCGACAGGGGATTGCAAAGG

Amplicon 5' Amplicon 3'
AGTCATGCAGAACCAGAGGCACTCCTTCAGATTGAACTCGCGCTTCTCCTCGTCGTCCTTGTACTTCTCTCGATTGTTCTGATAGCTATAGGGACTCCAGCGATCGAAGATCCACATGAGAAAGCTGGTAAAGAAGTAGGCAGCCAGGATGCAAAGCCACACGTTCGTTTCCAGCACGGTAAGGAACTTGAACAGCGAGCTTGGCGAACTGGGTCGCTGCATCATGATCGTAATCCCGACCAGATCGTAGTACGGAACGGTGAAGTCAATGACTATCTCCCGTTCGGCCATCACCGACATGCTGCCAAGGCCAATGTCCGCCTGTTTGTCCATCAGCTTCTTCACAATGCCATTCCATTGCCCATTCTCGTCCATGTTGCCAAACTTGCCGTCCTCCACCTCCTGGATGGTGTAATCGAAGTGGACAATTGCGGCTATCTCGTTGATCAGATCAATGCAGTATCCTTTGTATCCTTTCGGAGCCGTTTCATCGCGCATTATGAAAGGAGCTTGCTGTGAAGTTCAAATGAAATTTAGTTTATTGACTAAAACCACGTTGGTTTACCTTTAATATTTGGAATATATATTAATTTAAATGTAACTGAATATGATCAAAAGACGACACACACAAGGACTACAAGTTGAATACTTAAGAAATAAAAAAAAACTACACTACTAAAACATCCTTTGCAATCCCCTGTCG GCGACCCACCACTACAGTAAAGATTCGATAAACAGTGTCTGCAGTGAGATTCTTCATCTGCTCCTCGTCTTTGACGATGAGCTCCGAGTTCAGACCCGATATCCATTTGCCAATGGACTTGCTGTTCACGGAACTGCCACCACGAATCTGCAGCACATTTATATCCATTTCGAATTTCATGAAGCTATGCCCATTGAATGGCTGAGTGGATTGCGTGACGAGATCAAAGGTTCCATACGAAGTCGGTTCGGTAATCTGAGAAACGGAAGTGGGTAATCAATCAATCATAATTTCTTATACAGGTGGGAGCAGCAACCTTGGTGAAGTAATCTCGAAGATCCAAGTTCCTTTGGGGTGTGTTGCCACCTTGGAAATCGTCACAATTCAGATACTCCATATCCTTTGGCCAGGCGCCCGATTGTAACATTTCTCTGCAGGCAAAAATAGTTAAAATATATAGTAAATATACATCCAACCCACTTGATGGTAAGGAAACTCCTAAGTGCCAGATCGAAGTAAAACGCGGATGACAACTGCGGCTCCTCGTTCAGATTGTAAGTGGTTCGCAGTAATCCCAAGCGATCTCGATATTGCGTATACGCCATGGGTTTCATAAACATAATGGTCGCATTGTCCCGCTGACTGCTAATCTCTCCTTCGTTCTGAGTGATGGCGTGCCAGGCGAAGTTGCGCTCGAAATACGC


Search Again