CR01182

CRIMIC CR01182

Gene CG17593

CG17593

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK81211

Images

Construct Sequences

sgRNA sequence
CGATGAGAAGAGGTCAAATGCGG

Amplicon 5' Amplicon 3'
AGGCGTGTGCTTATTGGGAATACCGAATTGCATTCAAACTAAAAGGCACTAACGCGTTTTATTCTTCAATCTGCACGCGACTGTCACACTAACCATTTAACCTAGTTTTTTTTTCTTAATTAGTGTGAAAAGTTTTAGGACATTTAAATAAATTATAACTTAAGTGAACCGACTAGATTACGCCATCGTACTACCCCCAAGATGCGACCAGTATTTGCCTTCCTGCTCCTGGCGCTCATCTGCTTCGCCAGCACTAAGTCGGAGAGCGACTTCGAGGAAGACGACAGTGATGATTTTGCCGAATTCGACGACGGCAATTTTTACGCTGAGCCAGCGGCCAAGAATGCAGATTCGTTCTCCGGAGGAGCAGGATCCAGCCACGGCGAGTCCCGCGACGATCCGCCTGCCAAGGAGCCGCGGAAGCAAGCACAAAACCAGGAGAGCGACGAGGAGGACGGCCTTGTCGAGGATGACGATGAGTTTGAGCACTTCCAGGTAAACAAAGTCGGCTGTTCGATGAGAAGAG TGCGGTTAGGAACTTTGATCAAGAATATGCCCAGTGAAATGTAACTAGGCTTTCCTATAGGTGGCCTTGTGTTCCTTTACTTCCTTCATAAAATACTTGGTCATAAGGGTGCATAAAGAACCATTGGGAACATTTAATACATTGCTTTTAAACAGCTTTCACCATGATGACATGGAATTTTGCCGTACCTTACTTTAAATCTTCTTTAATGTGAAGTGCTTCTACAAATCTGTAATCGTTAGATAGTCATTGAATTATGTAACGTAGAAAGCAGTTGTAGTTTATACACTTTGTCGGAACCCTCATAACTTGTACTTCGAAATCAGGGAACCACGGGTTCACCAAAAGAGCAAAGGTGTAACAAGAAATTATTTATACCTACAATTGACTTAAACCTATTTCCAGGATGAGGAAGAGTTCGAGGGCTACGATGGCGGAGACTCCAAGGATCCGCCCATCGACCAAAAGGTTGAGCCAAAACTGAACATACCAAACATCCCTCTGCACTTCCGCACCCACTGGGACTCCTACTGGATGGAGATGCTCATGGTGGCAGGGTTGTTGGCCTACTTCGCCAACTTCTTTGCGGGAAAGGCCAAAAACGCGCGTTTGGCGCAGCTTTGGTTCAGTACCCACAGAGCCCTGCTGGATGAGAACTT


Search Again