CR01178

CRIMIC CR01178

Gene cutlet

CG33122

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK81210

Images

Construct Sequences

sgRNA sequence
CACTTTCCACAGGGCTTGGCCGG

Amplicon 5' Amplicon 3'
GTCTCAGACGCACCTGGAAAAGCACTGAGTGCATCGAGATCCGGTTCTGTTTGGAAGACATAGTGTCCTTCCTGGGACTTGACCTGCACAAACGTTAGGCCGAGATCAACCATCACCTCGATGGTGTGGCGCAAGTCCTGCTGCTCCCTGAGGTCATTTAAATATGCACTTATTGGAATGTTCCAAGGTAATCCGGGTATACTCACTTTGGCGATAGCAACTGCACCGCCACGGAGCGCAGTTGCGGCGATAGAATCCTCTTTAGCAGCGGCACCGTATCGAGAAGCAGAGTTCCGCCCTGACCCACACCCAGCGCAGAGGTGGTGACACCTTTGCAGAGGGCCTGAAAGATGTTTCTCTGGTTGGTGCTCTTCTGCTGGAACTGCAAGGATACAAAAAGAAGGGTTAGTCCTTGGGCAAACAGTGCGAAATCTATGCAGGAGTCTCATTAATCTTGTGATTGCATTTGAGGCACATAATGGACAAGAAATTACATGGCTTGATTGTGTTGATTATGCACTTTCCACAGGGCTT ATGTTTGCCCCGGCTAATGACGCCTGCATAAATCATGAGCCTGCCTCAAAGAAGCAGTCTCTCTGCGTTGAAAAGAAATAATGTGGCCCGGGGCCATCATCTCCTCATCGTCATCGTCATCGTTTCGTTTCTTTTTCTTTCAGCAGCTCACCTCAAAGCCACGCGTGGGAAATGCGATTTTTGGCCAAGCCAGTGTGGCGAACAGCAAATGCCAAGCGACGAAACCGTACTGCAGGTACGGGTACACACTGTAGTTCTGCTGTCTGCTGATCTGATGCTGCACTGTATCCGTGAAGCAAAACCATTTTAGGGCTTCGCACACGCCCGTAAAGTTTGGATCGGGCATCTTCTGTTGCAGGTAGTTCTCATACACGCCTTGCGTTAGTCTAAAGAGTGAAGGAAAATATAAATATCATTCGTCTATTTAATATAAGTTAACGTGCGATTACCTTTCATAATCCCCACTAGAGTGGACCACCTCTAGTACATTGCGAACTCGTGTTGTCACAGACGTGTTTGTCATGGTAACCTGGGCGGGCTCATCGACCTTATTGGCGTCTGTGTGCAGGGTTTTCCGCGGACGTTGTATCTGAAAACAGAAATAACATTAAATAGCACCCCACAAACACGCAACATACAAAAGCGCACCCGAAAAATAGCATCCCACACGGCGAACAGACCTTGATGCCTGTCCTTTTGTCCCAGATTGTTGTTCAGCACATCTTGCAGAGTAAGACTGTGCTTTTGAGCACTACAAGTTGAATTATCGTTAGTATAGTAATGAGTAAGTATTTGCTAATTACTCACTTAAAAAACTGCATGGATGATATACAGCTCCTCACATCGTTTCCGGATTTCTCAGCTAGCGCGATAAGTGAACCAAAGTCCGTCTTAAGCTGCTCTTTGAAGGCAATCTTAACTAATCTGAAAGTAAGATATAATTGCCTTCAGCATATATACTATATTTTAAATATATATAAAAGATATTGCCTCTCTGCCAGACGTGCTGCATCGATGGGCGGAAACGTGACCACAAAGGCCACCTGCCTTAAAGGGCGCAGGGCGGGATCGTAGACATCGTT


Search Again