CR01171

CRIMIC CR01171

Gene Spn42De

CG9460

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band short band81205

Images

Construct Sequences

sgRNA sequence
CTGCAGAGCATTTAGGTTATTGG

Amplicon 5' Amplicon 3'
ACTGCCGACGAGTTGAAACTGGGATTGGGTCTGGAAGGAGCTGGAAAGACCGAGGTGGCCGAGAAATTGGACCAGTTGTTGGCCAAGGGACAGTGGGAGAAGGCTAGTGGGGACGAGGACGTGCCCAAATTGAAGTATGCCAATCGGATTTTCGTGACTCAGAGATTCAAACTGACCCAGACCTATCAGGATTTGGTGAGCAAGAACTTCGCAGCAGCTGCAGAGAATGTGAACTTTACCCAAAAAGCGGACACAGCCAAGCACATTAATTCCTGGGTGGAGGAGCAGACTCATCAGCAAATCAAGGACCTCATTGCTCCGGAATCTCTGGACGCAGATACTTCGGCCATCCTGGTCAATGCCATCTACTTCAAGGCCGACTGGCAGAGCAGCTTTCCTGATTACGCCACTTACGCCAGCGACTTCGTCAACCACGGAGGTCGGAAGGTCAGCGTGGATACTATGTCCCAAGAGGATTACTTTAGGTTCGGCGAACTGACCGAGTTGAAGGCCAAGGTCGTGGAACTGCCCTACACAGGCACAGATATCGTTTTCCTGATCATCCTGCCTCAGGAGGAGCAGGGACTGGCCATCGTCGAGGAAAAACTGATGGGCATAGACCTCAATGAAATAAGCTCCCAATTGAGAAGGCGAAAGGTACGCGTGCAGCTGCCCAAATTCAAATTCGAATTTGATGTCCCTCTACAGGCAGCCCTCGAGGAGGTGAGTCCTTAAGCCTAAGATATCTAAATACTAGATTGGTGACCCGAATACTAGTGGCC AGTGGCCAATAACCTAAATGCTCTGCAGCTTTAAAATTCGATGTGTGCGATATGTTGTGTTGAACTATTTTTGAATGTTTGATATACCATAAATAGATTCGCCATGGCTGTCCGTTTGTCTGTTCTTATGAACCCCTTCAGAAGTAAAAGCTCGCGAAAAAGTTTTGATGGAGCATACAGACTCAATTTCAAAACATAACCACGTCCGGTAGACTTTTTGATAATATGTGTATATATAATATTTCTGAATATGTTTATTTAGAATAGAAAATAACTACTGATATACCAAAAACATTTTTGCTACTCCCATGAAGTACTTACATTCTTGAACAGCATTAATTTGGACTCTTTCAGTTGGGCATTAAGAAACTGTTCTCTCCTGGGGCAAATCTGAGCAGCCTGTACCAGGGATCGGAACCCCTACGCATCTCGGAGGTGAAGCACAAGGCGATCATCGAGGTTAACGAAAAGGGCACTACGGCCAGTGGAGCAACCTGTAAGTCTGTCCGTAAACATAAATATACGAACATTTTTGACAGTCTTTATTCCTTTCATTTCAGTTATCAAGGTCTCGGTGGAGTCGCTTACGATTGGAGAGGAAGTATTCGAGTTCATCGCGGATCATCCCTTCTTCTTTGCCATCAAGGATGCCCAAAACACCTTATTCCTGGGCCACGTCAGTCAGTTGTGAGTCGGCGCTGGAATTCCCCAATATGATGTTTTGTCCGCATCCAATAAATGCCAGTTCACGATGTCAAGTGCACAAGTACCGACAGGTATATCAACCTGGCTACTTGATTAGTTTTGGGTTGCATAATACTTTTGGCCTTCCTGTTTGCTGCTTCTGTAATTAGAGCCATCCGAGCTGACGTTGATAGTTTATTAAGAGGACTTGGCTCGGTTCAGCCTCCGATCCTGGCCGAGTGCCAGGCTCTTTGGCAGTCCTGTATCGGCCTCCTGTGTG


Search Again