CR01170

CRIMIC CR01170

Gene dx

CG3929

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK81204

Images

Construct Sequences

sgRNA sequence
TGATCCTGAAGAATTGGCTAAGG

Amplicon 5' Amplicon 3'
GTGCGGTATTTTCATCCGGCCTTATTTAGCCATTTTCCGCTGTTGTCTCTCATTAAATCGCTGTCCAACAATAAAAATTTCTCGCCTGCGCTTGCGCTAAATGCTAGAAAAACTGTTTTTACCATCAAACGTGAATTCTTAAGCTGCGCCTAAACGAAACCGAGTGACTAAAGAACCAGAACGAAAACTTCGGGAAAATGGAAGCCAGGGAAAATCAGGGATAACTAACGCTGGCAGCGGGTCCACCATTTTTAATTTCTTTGTTTATTTTGTGCCCATCTTCGCGAGCGAGCGAGATAGCGCGACAGCAACAGCAAGAGAGAGCGAGAGAGAGAGAGTGAGTGAGTGAGAGCTAGTGAAGAGAGCGCAGGAGGAGTTGGATATGGAAATGGGCATGGATATGGCAATGGGCTCACTCCACGGATAACGGATCAACTGCAAGCAATGGCCAGCAGCGCCGGAAGTGCGGCATCCGGATCCGTTGTTCCCGGTGGCGGAGGTAGCGCCGCCTCCAGTTGTGCCACCATGGCCCTGTCCACCGCCGGATCCGGTGGGCCGCCCGTGAACCACGCCCACGCCGTCTGCGTGTGGGAGTTCGAGTCGCGCGGCAAGTGGCTGCCCTATTCGCCGGCGGTGTCGCAGCACTTGGAACGCGCCCACGCCAAGAAACTGACGCGCGTCATGCTGAGCGATGCGGATCCCAGCCTGGAGCAGTACTACGTCAACGTGCGCACAATGACCCAGGAATCGGAGGCGGAAACGGCCGGCTCCGGCCTGCTGACCATCGGTGTTCGGCGCATGTTCTACGCACCCAGCTCGCCGGCGGGCAAGGGCACCAAGTGGGAGTGGTCGGGCGGCAGTGCCGATAGCAACAACGACTGGCGGCCCTACAACATGCACGTCCAGTGCATCATCGAGGACGCCTGGGCGAGGGTGAGTGCCGTGCAGAATCGAATGTTTTCCCATTGGCAGTCTAGTTGGAATTTTGAGTTGCTCAGGAATTTTTTTATCGGGAGAATATATGGGGAATCTTAAAAGAGTGTGGGTTTACCACTGATCCTGAAGAA AAGGATGCACCAGTCTGTGATGTGTCCATAGGTGTTTAAATAGTACATATAAGCCAAATTCCACAGTTCACATCTCAGCCAAAAAACGTAGTAGATCGAAGAAGTGTACCTTTTTGAATTTCTGATGCTTAGACAAATAAATCTGCATTTAAATTTTTTAGCTAAAATCAAATTAATTTTTTTTTCAAAAATTTCCATTTTTGCAACCTCAAAATGGGACAAAAAAATTGAAAAAAAATTTAATTTTCACTTTTGTAAAAGTTTGAATACAGAAACTTTCTGCTTTAAAAATAATGACTATTAAAATCATTCGCACTTAAATCGCTGGAGTTTTGGCTGAGTTATGGTATTATGATCAAATTTTAGGGGCTATATAAATTTATTCTTCTTCTTGCACAAAGTCCAACTGCAACCGCATATCAATCAATCAATATCATCAATTATAGATTGTAACATAACTTATTCCTACTCCCTTGCAGGGCGAACAAACCTTGGACCTGTGCAACACCCACATCGGCCTGCCGTACACCATTAACTTTTGCAATCTCACCCAGCTGCGCCAACCCAGCGGACCCATGCGCAGCATTCGGCGTACCCAACAGGCGCCGTATCCCTTGGTGAAACTAACGCCACAACAGGCCAACCAACTCAAGTCGAATTCCGCCAGCGTGAGCAGCCAGTACAACACTCTACCCAAACTGGGAGACACCAAGAGCCTGCACAGAGTGCCCATGACCAGGCAACAGCACCCATTGCCCACCAGCCATCAAGTGCAGCAGCAGCAGCATCAGCACCAGCATCAACAGCAGCAGCAGCAGCAACATCATCACCAGCATCAGCAACAACAGCATCAGCAACAGCAGCAACATCAGATGCAGCACCATCAAATCCATCATCAGACGGCGCCCAGGAAGCCGCCCAAGAAGCACAGCGAGATCTCCAC


Search Again