CR01169

CRIMIC CR01169

Gene ft

CG3352

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 long OK81203

Images

Construct Sequences

sgRNA sequence
TAACATTACCCAGTTTAAGCGGG

Amplicon 5' Amplicon 3'
GGTATCGCTCACCTGATGGGGAGTTTAAAGAATAATTTAAGAAAATACTCGATGCTGTATCTAAAATGGTTAGAAGATTTCTCACCTGTATAGTGGCATATGCCTCTGTGTACTGCACTCCGTCGGATACGCGAATCCTTAGCTCATACTTGCTCTTTGTCTCCCGATCGAGGGTATCGTTGAGGATCAGTTTTCCAGTGGACGGTTCCAGCAGGAACTTGCCATCGTGCCCATCCATCAGAAGGAACGTCACCGAACCAAGCGTATCCGGATCGTGGGCTCGCAGCGTAGAGATGGTGTGTCCAATCTGTAGATCCTCGCTGACATTGTAGACGAACGGTGTGTCGAGGAACTGCGGTGGACTATCGTTCTTGTCGAGAACGGTTACTCTGACCTGCAGAAAAGATACATACCAAAGTATTGCGTTGCGTCAATAACACTGACCCACTTGGCAGGAGGAGGAACCACAAACTGGCAACGGCGATATGGCATCGAGCGGAAACTTTAGTGCCATATTCGGCACTAAATGCCCAAAGTATTCCATGTACGAGCCTCCACTTATGTGCCCACCAAACTTTTGTCGCAATGTCAATCGCATTCTTCATCTCGCTTAACCTGGCCT TTGACCCGCTTAAACTGGGTAATGTTATATGGTTTATGGGATATGCGAAGCCAGTTGCCGCAGCTTGAACTTTCTGCTTATGACCGAGCGAATTATAGTTTAGGCCACTTCTCTCTGAACGAAACCGGCTTGTTAACCTTTATTGCGGCACTTTAATGTTTATAATTATTTTTCACTAGTTCTAATTAATGTACAATTTTGCAAGTGCCTTTCTAAAGTCATTATGTGTACAAGAGTCGGAAAGGACGAAGTATCGATATGCTCTTAGCATTTTTGTAAGTCCAGCTAACGCTCTACAAAATCCCACCTCTTATTTCTTGATAGTGTCGCGCACATGGAGGGCAGAAGAAGTGGAGCCCATGGGGCCATAAATTCTCGACACCAGATTCACTCGTAAAATATATAGCGTCGTGTGCTGAGGTGATGGTGTTAAGTCGGTGCCGGGCGAGTAAATACTGCATTTGTAATAAAATTTATGCAAATTGTGTAACATCAGACGGCGGAGGCTAGGACCCAGCTAGGAGATCCACTTCCACTCACGAATGCATTAGTGGGCAGCCATTGGAGCAAAACA


Search Again