CR01168

CRIMIC CR01168

Gene Cyp28d2

CG6081

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AAAGCGCAGTTTATACTTAATGG

Amplicon 5' Amplicon 3'
GTGTCCTATGCCGGTGCTAAACCAACCTACAAATTTTCTGTATAAAGAAAAAATGTAAAATGCGTATACAAAAAACAAAAATATTATGAATTCATAAAAGAAGAGATTAATTCTTTGAAAAAAAAAAATCGTAAAAATGCAATATGCATATTGACAAGTGACGTAAGTCCATCCAGTAAAAGATACCTATTTTGTTGTTAATATTTTTTGATAATCCTAATTATATTTGCCTTATACTTATCCAACTTGTTTATTACAACTATTTTCTATTATTTAATGCTTGGCCAATTATTATTGAGAAAATACATACATTTATTTATTAGGCCTATGAACGATTTACTATGTATAAAATTAAGTTTGATTTAAATGTTAAATTTGTGTACTTTGCTGCTTCTATCTGGTTATGAAATAATTAGCCGTTATCGAGTTAATATAATTTATGTAGCATTTTAAGATTTCCTTTCTTGTGAACAACTGTACCTTTATATGCATTATGATTATTAAAAAAAAAAAAAACAAATAAAAAATAAAACACATTGTTTTTTTTATACCTTTGAATTTATGTCTGCAGCTCTATTGACATAACTATATACGTTTTGGTTTTACAGGTTTCATGCTTATCGATATTTTATTACCTATCTTGTTTAATTGACTTTTGATCGAGCGCTACGAGATTAATGCAATCAGACTAAAAAAAAACAAACAAATTTTAAAAGAGGAAATTTATTAAAATACGATTAGATTGCTTCCAGCGCGTGTCTATTTTTTTGGCATAAATATAGGCCCCTGCGTTAATCTGTAGCCCATAAGCTTCCAACATGTGCCCAGTAACTACATTTCTTGTCCTCGTGCTGACCCTGTTGGTTCTGGTCTACGTGTTTCTGACATGGAACTTCAACTATTGGAGAAAACGTGGCATCAAGACGGCTCCCACATGGCCATTTGTTGGAAGTTTTCCCAGCATTTTCACAAGAAAGCGAAATATTGCCTACGATATTGATGATATCTATGAGTATGTATACAATATGAGTGAGAAGGGCAAGCTATAGTTATGTTGTATAATAGTGGAGTCAAAGCGCAG ATCAGAACAGTCTTCTCTAGAGCTAATATAAGTTACTTTTTGATGTGAACTTTTTGTTTTTGCAGAAAGTATAAAGACACGGACAATATGGTGGGCGTTTTTACCACCCGAGTGCCCCAATTGCTGGTCATGTGTCCGGAATATATACACAAGATCTATGCAACCGATTTCCGTAGCTTTCATAACAATGAATGGCGTAATTTTGTAAGTACTCGTAAGTTTAGTAAATAATGGATAATCCATTACTGAATTACAATGTTCATAGGTGAACAAAAAGACGGACATGATATTGGGCAACAATCCGTTCGTGTTAACTGGCGACGAGTGGAAGGAAAGAAGGTCGGAGATCATGCCAGCACTGTCCCCCAATCGAGTAAGGAACCACATTAACCATCTATCCAATCAAAATTCTATCTTTGAATTCCGTAAGGTCAAGGCCGTTTATCCAGTATCGCAGAGCGTATGCAAAAAGTTCGTGGAATATATCAGGCGACAGCAGCAGATGGCCACCTCCGAGGGATTGGACGCCATGGATCTGTCTCTTTGCTACACCACCGAAGTAGTTTCCGACTGCGGACTGGGAGTATCGGCCCAGAGTTTCACGGACACTCCCACGCCGCTGTTGAAAATGATAAAGCGTGTGTTCAATACCTCCTTTGAGTTCATCTTCTACAGCGTTGTTACCAACCTGTGGCAAAAGGTGCGCAAGTTCTACAGCGTACCGTTCTTCAACAAGGAAACGGAAGTGTTCTTCCTGGACATCATCCGGCGATGCATTACTTTGAGACTGGAAAAACCAGAGCAACAGCGCGACGATTTCCTCAACTATATGCTGCAGTTGCAGGAGAAGAAGGGCCTGCACACGGATAACATCCTGATAAATACGATGACCTTCATTCTAGACGGATTCGAGACTACGGCTC


Search Again