CR01157

CRIMIC CR01157

Gene CG14964

CG14964

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CTGGTGGGAGCGCTAGAAATGGG

Amplicon 5' Amplicon 3'
CTCGTAGGTGCGGGGTAATCGGATCTTGGGAGGAGCCTGCACCATCAACCTTGCCTTGGTAATCACATGTCCCGCTCGATTGGTGGCCGTGCATTTTATCTCGCCCTCGTCGGTCAGCGCCACTTGGTGGATCACCAGGACACTGGCCTCGTTGTCGTTGACGATCTTTGTGCGCCGACTGCTGAAGATCTCGTAGCCGTCCTTGAACCAGTTAATCTCCGGCGGCGGTTCGCCAAGAATGCGGACGCGGAACTCGATTCGCTCGTCTTCCACGGCATTCGTGTCCACCAGTTCGTCGATGAACCGGGGCACGGTTATGGCATTTCGCTGCAGCGTCACCGTCAGCGGATCAGATAGCTCGCTGGCATCGGATCGCCCCACAATGTTCTCAGCAAAGCAACGAAACTGGTAACGCCATCCCGGCTCCAGTCCACTGATGCACACATCGCAGCGGTCCACGGGAGTGGGCGTGGCTCTCACCCAGTGGGGTGACCCCATGCGCCTGTGCTCTACCGTATAGCCAGTGATGGGTGAACCTCCATCGTGGAGTGGCCGATCCCAGCGCAGGTTCACCACGTCCGGTTGCTGCTCCGGTAGTGCCACTGGCGTCAGGATGGGTCGGCCAGGCGGAGAAGGTCGCTCTGATTGGGAAACAAATATAATGCAATTTAAGGATTAAAAGATCTAAAAATCTTCTACGATGCGAGAAAAAAAGTTAAACTTTAAAGGAAATAGAGAAATATTTGATTTTTTAATTAAGATAACCTACGATTTATTCCTAAATATAAGTTGCATAGTTTTAGAGAATCAATTTCGATTCACAAAGATTGCATTGCTAAGTTATTACGGTGTGGGTGACTTTCCTGTCCCAGCTCCATATTGTAGCCCTTAAAGGGCTTTAGAAATTATGCACCTACAAAAGATTCTATCTCAGCATAATGATTCTTCCGCTTCTCAAACGACAACATTACTTTGACGTTGCGAGATTTTGGGGCCAAACAGACGAACACGGCAACCACTGAGTGTGCGAGTGGCTAA CACCAGCCAGACAGCTATGTGGGGCCTCCTCTGATATCTTGAAATTCGGGTAGGAATTGTACTGGGACTGGGACCCTGATGGTATATGGAGTTACTACTTTTCTACTTGCCTGCGGACTTCCAGTGGACATTCTTCTTGGGGCGACCGCCTTGTGGATGCGTGTGCAGCTTTCCCGGCTGATTTCCCATTTCGAGATATTTAGATATTTAACCTATTTGCAATATTGTGCTTGCCTATACAGAGGATCTATATATAGACAGTCGAAATTAACTTAACTTAACCCGTCGTTTTCGAATCGCCAATAACAACACTTTGCACTCCAACTATTTCAACTTCAGGTCGGTTAGTTTCTAGTAATGTAACTTTCGTAGCGTTCGCAGGCTTTTGTTTGCAAGCGTTGCCATTTTTGCGGCGCGTTAAATAATCCGTTCCGTTCGGTTCGTCAGCCCAGCATCCTCCTCCTCATCCACCGATCCACGAAAGCTTTCTGCTCTCTTTCAAATTTGAATTCTGATGGGCTCGACAGCAGTTATCGACATCGATAGGAGCTGCAATCGGTTAGCAAGTGACCTACCTTCTTTCTGGCTACTTTTCAGGAACTTCGTTTGACAGATAACCCTTAATTAACCACAACAAGGCTGATCACATTGTAAAATAAGTCTCATTTACAATGCATTTAGATACCATCAACGATAGCATCGATTCATTCGATAAGCTTTAGCATCATTCAAAGTCAATTAACTATCTCTGTGATTTGTGGAATTTAGCTATTTCTAGCTAGTTAGCTACTTGTCGCAAAGTTCCATCACTAGACCCCTCCACCGCATTCGATAGTTGGCAGCATTAGCGAAGTGTCATCACCGGCACAAATTATGCTTTTTTTCCAACAGTCCAGTCTTCCCAAAAATATTTCGCTAATTTTTTAGAGTGCTGCCTTGTAGTGTTCCTTGTTGCTTAGTTTGTTAAAGCCAATTTAATCCGCGAAGTGCTCTCCAACGTATTTTAGTGTTGTTACAAACTGTGATCTTGCGACTTGCCTGCATGTGCAATGTGAAAATGCCCCGTCCTTGGCATAAATTTCGGGAGGCTGTTGTTGGACTTTACTTCTTGAAAAAATAGAAACTATCTCGCCCAGCATCACAGTTTGGAGGAGCCG


Search Again