CR01154

CRIMIC CR01154

Gene Grd

CG7446

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short81196

Images

Construct Sequences

sgRNA sequence
GACGCGGTCGGAGCGCTGATGGG

Amplicon 5' Amplicon 3'
AACTGACCTCATCGCAGCAAGGAGCCTCTCCAGCCACCAAGGACAGCGCTCCAACTTGCGCATATTTAAACTTTTGATTAGCTGCTGCCTCTTAATGTTGTGCATTTACCCAAATGCCTGGCCCTGGTCCATCGGCCCCGGATCGGGACCCTTCTCTGTCTCGGCCGACAGCATCAAGGGCCGCGGCGATACTCACCGCCTGGGTGAGATGGGCACCTCCTTATCGTCATCCCTGCCGTCCTCGTGGCTCACCCAGAGCAATAACCATGCAAATATATCCGAGTTACTGGACAATCTGCTGCGCGGCTATGACAATAGCATACGTCCGGATTTCGGTGGTAAGTAAGCGAAAAGTCAGAAAAAAGATAGGATAAACTATATACTTGTTGAGTTAGTGCGTAGAATGTTATTCTGACAGATCCATAGAAATGTCGATTAATTAAGTTGATTATGTTTACTGGTCAAGAACAGAATTATGATACCTTTAATGACTACAGGTGTGTTATTAGGTAATAACATTACATAAATAAGTTTATTTTTTCATGCTTTCTATGACAACCATGATAAGTATTATTACTGATTTGGAGTACCAAACATCCCCAAATCATTCAGCCTGTTCCAATTCCTGCGTTGTTTACCCTTTTGACTCCTTCCCCATTCCAAGTGTAATCAGCATAGATTCGCAGATTTTCCGCTCAACGGAAGCATTTAATGAAGCGGAAATCGCTGCGAGGCGACACATCACTCACAAACGGCACCAAGGTGATGAATCGTGCCTTGATGATTGCCTCGCAGCTTATTTGGTAAATAGTTAGTGTCAAAACCGACAAATATTTACCAACACACAAACAATTTTATTTTGCTTTTCCAAGCAACCAGAGCTTTTACTTCGAGGACATTGCACAAAACGGATAAGCAATTCGATTCGTTTTCAATCTCGCAAATGGATGAGGCAATAAAAATTTAAATATTTTCGAAATTTAAAATGCCATTCCACTCAATTGGGGAATGGATTTTGGTCAACGTGGCGAAAATTGTTTTCGCTCAACGGCTTAAGACCAAATTACATTGTTTTTAACACTTCATTAAGAATGTGCCGTGGC GTTTGGCGCCAGCTGGAGAGGATTCAAAGGATACGCGGCAATGCACATCCGCATCCTGCGAGCGCGACGCATGTTTGCCGAGCGAGCTCAGCAGCAAAGTCATTAAAAACTGTTCGCATAGGCAAAAATACAAAAAATTCCTGGGGGCTTCGGGAGGAGGCGAATCTAGGGCCTGAAAAATTGCATATTAGTGCAGAAAAGCTAGATAAAAATGAGTGTCAGCCGGGGATGGTAACAGATTCAGAGGGTTTGGGACTGTCTGCGAAGCGGCTTAAGTGTCATTGTTCGCACAGAGGAGCATTTAACATTTTCATTTGGGGGCTGCGACTCAAATATGAATATTCATGGTTGAACAAAACCGATACGCAGAGTACGGGGATTATATAGTTGGATTGCGTGGCCTTCAGTTGAAGCAAATCCCATTTCCATAACTAAACTAGTCACAGGCTTGAATGGTAAGCTGTGAGGAAGGTAATAATGTCACAATAAGCCTTGCAACTAAAGTATGTAATACGCAATACATTCATATTCAGCATAGGTTAGTTTTAAATATTAAATATTCTAAAAATATACTTGGATTTTCATACAAAAAACTTTGTTTCGTTACAAACTTTCACTTTATTTCAGGACCTCCAGCCACTATTGAAGTGGATATAATGGTTCGCAGCATGGGCCCAATATCAGAGGTCGATATGGTATGAATAGAATATAGAACATAGAAATATTAATAATATTATTAATTAATTAATTACTTACTTAATTACAATTATATTATTTCCTATACAATAGGAATCATTTTAATCGAAATATCTTTATTCAAAATGTAAGATTACAAACATACGTACCTTAATACATAATGATATTTCTTATTATTTGAAATCTTAAGTTAAAGATTCTAAAGATTCTTTTAATTAGATCTGATTTTTCTGTTTTTCTGATAAGAATCCATAGAAACAAGCTGACAACGCAGCATTTCTGCTTCCCAATTCAATTTGCAGTGACATCTCCTGTCTGACTTTCTTGCTTTTCTGCAATTCAGACTCAGCCGATTTTCTTTATTGCAGACCTACTCGATGGACTGTTATTTCCGCCAATCCTGGGTGGATAAACGTCTCGCATTCGAGGGCGCCCAGGACACGCTGGCACTGAGCGTCTCGATGTTGGCACGGATTTGG


Search Again