CR01151

CRIMIC CR01151

Gene CG10936

CG10936

Information

Donor Location Cytology FBti Stock number
pM37-p12R:17629396..1762939654D2Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GATCGACTCTATCTTTGCCGAAGAGG CAATGGAGTCTCTCCTTCGCTCAGAA

Images

Construct Design Sequences

sgRNA sequence GTAGTTAAGGTGGCCCATTGCGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TTCAGTTTTGGGGCCACACT TTGCGGCTGCCATCGTTG ATGGGCCACCTTAACTACGT TCGTGCAGAAACTCTGGCAT
 
Amplicon 5' Amplicon 3'
TTCAGTTTTGGGGCCACACTGAGCCCGGTTGACTAAAGTTCGATTCAATGACATTTAAACATTTAAGCCGGGTGTCTTAGCCAATGTAGTGGCAGCTCACTTTTGTGTGGTTAGAACAAGATATTGCTTATAATATTGATTGAAATAACTTATGTGGATCGTTAGGAAAAAGTGGTTTGACCTTCGAATTTAAATTCTCTAATCGCTGGCAAAGACATCACAAAGTATCAGTTGTCAGGCCAAAAACAAAATTTATTGGGGAAAAAGGTTAGTATATCAGGTTACTTGAAACCATTGATATGTACATTTTTCAACATGTACGGAGAAAACATAAAACATAGTATAAACACAACTCGGTGTTTTTCCTTTGAATAGATCAATTTGATGGGTCAGCTGGAGTTTACCCAGCTTAGATGCGATGACCTTGAACTTGGAGTCGATTATGTTGTGTGATGTGAATTTTTCTTTTTGGCCAAAACGTTGTACAAACCTAAAAACAAAAACAAAAGAAAAACGACATGAAAAACAAATTTTTTTTATTGCTACAAAAACTTATTTTAATGTTGCACTACAAACAAAAATAAAAGCACTCATAAAAACAAACAAAGGCAATTTAATTATCTTAACGGGCGTGAAATTAACATTAAGAGGAGCTGACCCGCTGTTTCAGGTTCTTGGGGCGTGGTCAACAAAAAAAGCGAAAGAGATATAAGCTCGTAAGAAACAAAGCAAGGTCGCCGAAGACGGGGATGCACTTGCGTTTAAAGAAAAGGGAAAACTGAACTAGTTTTCCGAGGTCAAGCGATTAAAGATATAACAGTGAAAAATAATTGAATTGAGCTTATAAAAGTGAAATATACACTTGATCAATGCAACACTTGGATCTACATATATAAATAGCTTAAGTAATTGTTAGCTTGTCAAGAGTAATTTGAAGCTCAGAATTACCAAGACCAACCTTTGAAATCACTCCATCGGGTATTATCCGATGATAAATATCCCATCAACAATCAATCAGCTCTTGTAATGGAGCCAACCAAATTTAGCGCAGCATCGGTTTAACCAACATTGGGAAATCTAACCACATCTCCCGCAGCTGTTGTTGCTGCAACAAATATGCACAACGATGGCAGCCGCAA ATGGGCCACCTTAACTACGTATAATTGCTGTTCCAATAACCCCTAACCCGGCGGCACAAAGCACATACACAAGAGATGCCAAACAGCGGCAGCAAATTGTGACTCGTGCCAACAAACAACAAGCAGATATATATTAAACTGTCAAACAAAATCATAAATATGGAAAACACACCCACTCTCTTGCCAATCGAGTGAAAAAAGCTAGTTCACTTGGACAGCAGATGGGGCAGGATTAAATTGCAGTGTGAAATGCAGTAGGAAAGATTAGGGGAAGGGAGACGCTCCTCCTCTGCATATGACTGCATATTATATTATTGTATCTGTTTGCTGCCCCTCAACCTAAGCGACCCAAAATGTTGCTGCTGGCCGCAGTCGACCACAAAACAACATCAACATCCAGCCAAGAAATGCGTTCGTTGCTGTTTTTGGTAATAAACGAAGCGTTAAACAAAATGCACTACAACAGCAGCAACAACCAACCAACCACCACCAACAACAACAACATAGAAAACAAACATTTTGTGTCTTTCTGATTTGTTGTTTACCATATGCAAAGCGTCATATATGAGGTTGCCTACAGTTGCAGTTGTTACCGGTTACTTGTTGCTGCCTTGGGCGTAATTACATCTCCAAACCAAAAATGGTCAAACGAGCGAGAAAATTATCACATACGAGGTCCTCATTGTTGTTGCTGCTCTTGTGGCGGCAGAAATTAAATGCAAATTTTGCCTGATAAAGAAATATGGGGTTACAGACGAAATTTCACAATCAGGAAATTAAGCATTTTTCTTTTTCGGCTGTCTCGAGCGGTGGAAGCCAAAATAGCCTTCGATGATTTGACATCTGATAGGTAATTTGAATATTTTTGGTAGGCCAATTAATGAGCGGAAACTTTTACAAGCATTTTGAAAGCATATGAGGGATACGTTTCCCTTTTTCTATTTCGCCTTCCATCAAACACTCCTCGGAAATGCCAGAGTTTCTGCACGA
 

Search Again