CR01143

CRIMIC CR01143

Gene CG5853

CG5853

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATCATCTGCAGGCTATAACTTGG

Amplicon 5' Amplicon 3'
TGCACGAGCTACTGTCCAAGCCACTGAAAGAAAGAAAAGCAAGATGTAAACATTCCTCAGTTTGTTAAAAATGGATATATTGGCTCATACGTTGTGGGCTCGTCCAGGAACATCACAGTGGGATTATTGATCAACTCCATGGCAATGGATAGCCTCTTCTTCTGACCACCGGACAGGCGCATTGTAAGGGTCTGATCGTGATTGTACAGACCAAGGAGCAGCAGAATGTCCTCGATCTGCAAGGGTAAATCCGCGATTTATGACTATGATCTTTAAGTGAAGATCACCCCACTCACCCTGCTCTCCTTCTCCTCGTAGCTGACTGTCTGACCCAGTTTAAGATCGGCGGCTATATGCATATTCTCGTTTACCGTCAGCAGCGGCTGCAGACGATCATCCTGGGTGATGTAGCAGGACATCCGACGGAAGGAAGCTGCAGGGAGGGATTACCATGAATTCTGGATATATTGAATAAATTAAGTGAGGTCATATACTAACGCAAATCACGTCGCCGACCATTGAGCAAGATGGAGCCATCCACTCCGGTCGTCTTGAAACCTGAAAGGGCATCTAGCAAAGTGGACTTTCCTGCACCCGAAGGTCCCATGATGGCAATCAGCTGGCTGCCTGGGAACTTTCCGCACACATTGTGCAAGATTTCCTTGGATCCTAAGAAATTGCGAAATTACTTAAATGCCATCGTAAAATATGATCATAAAAACTTAATAGACATTCAGTGTGTTTTTTTTTTATACGGTCGTCGGTATCAAGGTTCAGGGAACCAATGGAGAACCCATGAGTACGCGTACGAGCGACGATATTCATGA ACTTGGCTGAATTAAACGGCTATTGAGGTAAGATCTCGAGTAAATCTACATTAATCCACTTCAGTGAATAACCTGTTAACTACACAACTCGAAAACAATTCAAATCAGTAAACAATTCTAGGTGATATACGTATCAAGCCATAGAAAAGAGTTGCAAATATAGGGAAAAAGGGTTTAGCTTAATTAACTCAATCTTTCACAGTAATCGTATTGTTATGTTAGCAATATTACACATTTTAGCACTTCTAGTCACCAATTTAACATTCCGATAGCAATGGCCATATATCCACCTACCGAAAGGTTGATTAATTAATTACCGCCACGGGTTGAAAATTTGTGCAGTTCTAATCAAGTTACCAGGGGCTAAACAATGTCGATATCTTTTGAACTTTGAAATTAGCAAAATGTTCTAAAGCCAAACCCATCATATCGAATTACAAATGCTCTACTAACTATCGTATTGGCAAGTTATTTCTTATCATTTTATGGACTCGACGGAAAGGGAATTTATGAATGACTAACTGGCATTGAATATATACAACCGGGAAGGGGGTGTGATCGGAATAAGCGGAGTGATCGGCTCTTATCTAATCAATGGAAAACCAAGTTGGTTAAAGAACTAGCAAGCAAGTGTTTGGCAAGTGATTGGTATGTGGAGGCACTGCCGAAAAGAATAACCTTGTAGTAAACTTTGTTCGGATGTAATTATCTTATGGCACTCGTACTTAAGAAACATTTGAAATATAGTATCTGAAGGATTTGCTTTATCTGAGTATATCTGTATCCCTTAGAATACTATTAATGAAAAGACTTTCTAGCATATGTTTTATCTTCTATTATAACAGTAGTTTTGTCTAGTCATAATTTAGATATTATTTATGAGACTATATTGGTAGGATATAAAGAATTGAAGGTCATTCCCGTTCAAAGAGTAGCCGCTGATCGTAAAACATATATAAATGCCCAGCTAATTTTAAGTTCTCCGCTGCCCCAATCTTATCGAGCCATATCTTAGATCATGCGATCGCAATGGTTAGTTAGCGACAACTCGCTTCTTGTAGCTCACCTCGATTGAAGCCCAATTTGACGGTGAGGGA


Search Again