CR01124

CRIMIC CR01124

Gene Mmp2

CG1794

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK81180

Images

Construct Sequences

sgRNA sequence
GGATGCATGGATACGAGCACTGG

Amplicon 5' Amplicon 3'
GATTTTGCCCGCATGTGGTTTCGGTGTAACACGCCCTGCACTTGGCGAAAAACATATGTCGATTATGACAACAAATGCATTGTACAACCTAATTAGTCAGCATCCCCTGCACATCGTGCTTTACTGCTATTTAATAATACTAACAATAAGTTTTCGAATTAATAAAAATAAATGGCAATTTCAAATGATATTCATAAAAGTACGTATCACGCCCTGCACTTAACGAAAATGTGGAAGTCATTCGTGACAAAAAATCTTCATTATTTTGCCATACACACTACAATTATTTAAATGAATAATCAAATAGATAGCAATAAGTTGCGTTTGTCAAACAAATTACTATTGAAAATGTGTAATAAACGCCCCACACTTAGCAAACATATAGCGGTCAATTTTGCGTTATTACACAACTTCATTAATAAACTAACGATTTAAATATAATCGAATTTTTCCCAGTGCAAACCCAAAAAAACCGCAGACCAGACAGCGCCGCCAAAACACTATTGCCCTCTAATGCAATTAGTTAACGTCAAAAGAAGAGCATTATTATGTGGCCTGGCCAACGGACTTGATGAACTGCACCCACCATGGCTATCATCGGATTCGCCGTCAAAGTTCCACGTCTCGTCCGCATCGAAATGGGCATCTCCGCCACGCCCCTCGCCGGGATAGAAGGCGTGGGCCAGCACCTGACCAGGTCCATCGAATTTATAGCCATCTCCGTGCGCGCGCCTGCAAAGTGAAGAGAAAAGGACCAGCGTAGATGTCCTGGATTAGTTCGGTGTTCCAGTGGAATTACGAGCATGGCCAAGGGGGAAATCATATTCACAGCTTATCTAAGAACAAGCAGCTGCCACATAAACTCTTTGATTCAGACACGGCAGCCATGGCCATCGACTTTGTCATCGGTGGCATTTCATCATCGACGTCGTTGGATGGCCATGGATTTAATACTTGGCTTATTTATCGTTCGCCTGCTTTTAAGTGCAATTTTATGTGCGTTTGTTTATGGCACTAAAGACTCGCTTTTTTATGATCTTCCCCACCACCTACCACCAGTG CAATCGCCCGATTCGCAATCCCCATAGATTTCGGAGTACTTACCGCGCAAAGAGTATCTGAATGTCGGCCTGGTCGCTGTAGACCTCGCGGAATGTCAGCTTCGAGTGGTTCGCCCAAACGTCCAGGGCGGTCTGCACCATTCTCTCGACTTTGGAGGCATCGGGCATCGACCTGTTGACCATGCTGCAAGGAAAGACGAAGGAAGAAACATGATATCAGCATGCTAAGATATTCCACTTTGTAAGGGTTTCATCCTTTGCATAATACACACAAAGAGAATAAAGTGATATGGTATATATATCATGGATATTTATATTTATATTTATAGTTATATATTTGTGGCAGCATTGAATGCTTGGCATAATTATACCTGATGGAAATTATAATAAGTAAACCAAAGTCCCAACTTAACCTTTACAAAACCTTCAAACAAGTTAGGATTGTCCTACTATGGATATAAACAAATTTTCTTTCCGTGCACGCCTTGTAGGCACCGAGTCTCCGTCTTATCTTGGAATATTTTGCAAACCGCTAATATGGTGGCCAGTGCCAACTTTCACCCGCCCACACACTCCACTTTCACTTTGTCATGCTAAAGTTTCGCTCACTTAAATACATGGGCGGCGGGTCGGAGTTTGGTGGCCTGCACTTAGTTTAGTATTTTGTGAACTCTGTCTAAAAGAGTCGGGCAAACACACATAGTACCTGAGAAGTACCAAAACCTGGCTCAAACCGCAGCGGGTTTGCCTTTTGGCGTCAACTCTCCACTGGCGACTTTGCCCCATTTCCGTCAACAAAGTTTCCGTATTTCCACTCCCGCCGCTCCGGACAAACTGAGATATCTGTGTGCTGCTGCCGTGTTTCCGCATTTTATGCAAATTAGTTATGTTTCTTTTATGCCGGACCCAGTCTGTGGCTGCTCCTGCTGCTGTTAACTAACGCAGAAAAAATAGGGGCCGAAAGTTGATCCTTTTTGCGGTTTACCCAGGACCTTGTTTGCCTCTCTGCCGTATGCTTTCTCCATACCAATTTGCCGGCGCTTTTTATTCCCTTGCCTAGTTTGACTTTCAGCCATTGTCTTTTGGCCAGGATTCTCTAGGTGC


Search Again