CR01120

CRIMIC CR01120

Gene eys

CG33955

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 short band OK81179

Images

Construct Sequences

sgRNA sequence
AACAACAGGCGAGTGTATCTGGG

Amplicon 5' Amplicon 3'
TAGCTCCATGGGAAAGCTGCAAGTCAAATGCGAAATGCGAAAACCAGAAGCTTGAAATCGCTTCCCGCCTGCATTTCCCCTCCCCATCAACCAATAGGAGTGGAAAAACTCAGGCTGGCCAAGGCGGATGGATGGGAAAGTTTATATGCTGGCAGGCGAAATTTATAGCTGCAATTAAATTTAACACGATGCCATGAGATTTAAACGGATTAACTGAATAGTTTTCGACCAGCTCAAACTTTGGGGTCGACTGCGTCGAGGGGGAAATATCGCGAGGAGTTTACTGGCTTCGTAGAACATTGATATTTTATTGGTTTATCCTGGCTTATTCGAGCGATAAGATGGCTCTTAACCGTTTTATGACTTCGCTCTGCACGCTCCAATAAAAGTTGGCTATTCAAGATGAGCAAAAGGATATGATTTGCTTGGCAAATTGCCAAAGCCATTAATCGTGCACTTCATTTAGTCATGATAAAATCGGAATGAGAAAATTTCTAAATTATGTCTTTAAATGCTTTCGATTAGAACTCGGCGCAGAGTAATGGTTAAATTATTATGCAATACATTATTGATTACCCCCAATATTTATAAATAGAGTAAATGCTTCGCAGGACCACAAAAAATTAGCCACTCCAGCGAGCGTCCAATATCCTGATGGCCAGGCACTCTGATATTCCGTCCACAAGGAGCCAGTCCAATGCCATTACGTAGTCATTTCCCAATTGCTCCTGGCTGAGCACAACAAATCAAATAGTCTCCCGGGTGAAAATGTCCAACCGTAGCCCATAATCAGCCGAACTGGAATCTCAGGGGCTTCACTGGTGAACTGAAAACAAGGGCCGGGAACAACAGGCGAGTGTA TTATGCCGTGCCAAGACCATAACAGACATGTGCACCGGGAGCCATCAGCTGCCTCCTGCATCCTAATGTAATCCATTATAAGGGACAACAGTAAGCCAAAGCTACCTACATACCCCCGCACCCCAGCCCCACTGGCCCATTTACACGGCAAAGAAACTTCTTTAATTAAGCCGGTTACCTGGCAGCAGTTCCTGTTTGCCATGTTTGCAGTGCTCCTCGGATAGCACTCGTCCACAGTTCCCCTGACACTTTTTTCGCTCTTTGCATTTCCGTTTCCGTTTCGATCCGAACTCGGCTTGGCCAAAATATAAATAGAAATGGAAATAGAAATAGGAATGAAAATGGAAAACCCAATCCCAAATGTCTACCAAATATTTATTTGCACAACTCCTCAAGTCCAATGTTGCGCTCTTTGAATGTTTATAGCACTCAACTGGCCGGCGATTTAACTGCAGGGCATGTGCATTATGTCTGAATGTAGGGGATCTGAGCCTGAAAAGTCGGGGAAATTTATTCAGGAAAATACTGGACTGCAGGCCAAAACAAATGCGAGACTCGAGTGCCACCAGCTCAGTTCCATTTTCATAATTGTGAAATATGCATATGCAGAATATTAAGATAGAAGCAAAAGTAGTATAAAATATAGATGTATGATTGACTAATATTGTTTAAAGAATTGATCTAGATATATATCTCAGGGAGATGGCGAATTTATACGTGTCCGCCCATCTGCACTTCAATTACTGCCTACTGCCATTATAGTCCGGCTGTATCTGTATCTGTGTATCTGTATCTGTTCCTGCCCTCCCGAAACAATTTGTATCCAAAGCATTTGGTTTGTTCTGCCACTAAACCTTCGTTTTCTCTGTTTTCTTTTGGTGGTGCTGCAATCCGGCTGTTTTTTACCACCGTTTGATGCATCATTGACACACCGTTCCGCACACCCACCGCACCCGGATGGAAACAACTAAAACAACAGCTCGTACTCGTGTTACTGCATTGATGGCTACACAGGGATCCAGTG


Search Again