CR01112

CRIMIC CR01112

Gene CG7432

CG7432

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 multi OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
GTGACTGTTCTACCGGTTCGTGG

Amplicon 5' Amplicon 3'
CGAAGGTGTTTCTGCTGTGCCTGGGTTGGTATTGGAAAGAAAAACAACATATGATTGTCCCCAAAATTAACAAATAATTAACCTACTTTTGGGCATCCCAAGCATTTATTTGGTAACAATTTATCACCCTCTTATGGTTAATTTGTGCTAATGTGCTGCGCAAAATATATCAATGAAAAAACAAAAGACTTAGGCAACGAACAGGCTGTTGCGCATCCGACGAAAGTCCGAATGCAGCTGATGATTGCGGTTTGTTGTATATTTTTTTTCATTTGTGGCTATCATCATGATTCGTGCAACGTGAGGCAGCTTGCAACTTTCTTTGGCCGCCACTGCCAATAAAACTTCCGCTCGGTGACGTCACAGACAGGTCGAAAACCAGCTGGCATGCAAATCACATAGATAACGCCACCAAGGCCAATCGCATATCTCCCCTGGCCCAAAGAGTACACTTGTGTACGTGTTTCTTAGTATTACCGCAACGCCAGGCTTGACCATTTATTATGCAATAAACAAAATAAAAGAAAGAAAAAAGTTGTCAACGCCGCAATTTGTTGGCCGTTTGGTAAGTTTGGCCTGGCCATTGCCGGCTGCCAAAACTCCAGGCGGTTTGCCGATTGCCTGACCATGAAGTGTACAATTTTTGAGATTTCTGCTTCGGAAGTTAATGCAGCCGCTGTTTCTTTCGATTTTCCCCGTTTTGTCCCTCTGCGGGGATTAGCTTGTAATTTTCCATCAGCGGCTATTGCAGCGTTGACATTTCAACTGCTTTCTTCGGGATTTTCACTTTCGTTAGCCGACCGATGATAGAAAGAGTGTTAACTCGGAGCTGACAAAACTCCTAGCCTTGGTTAATTGGATTTATGATTTTGGGAGAATTGATTTAGTAATGTATAAAATATTTAGAAAAAAAACGATATTTAGTGCTAAAAACTCGGGTTCCTCGACTACCAGATACCCATTGCTCTGCTATTGCG GCGTGGCAAAGCTCTTCTGTTGCACAAAGAAGAACATTATGCTTCCTTCCACCTGTTGCGTACTTAACAACGAATATAGTAAACTCTTTTAGTCAACGAGTAACGGGTATATTTACTTCTTTATTAAAATACAAATGCTGTCGTTTATATTGTAAACAAGAAATAAGGAAATAATTTTAAACAGAAATAGAATTAAGAATTTTCAATGTTATTTTCACTTATTTCTTTGAACGGTGTGACATGTTTTTGGGTCAAAATGCATAAAAGTATGATCAACAATGAACCAAAAAGAGCGCACGTATCCATAACGAATGTGCTTAGTCTGTCTAGGGCCTCCGGGGCATTCACTTTTCCCAAGAAATCATTTCTATATAAGCCCTATAATTGGCCAATATTTCATTGTGTTGAGGCGAGCAGCAACAAAGTGAAGCAGTGCCATTTGGTATGGGCAATTTTATTCCGAGTGAAAGTGGCAAAGTTGCAGTGCACACCTCGAAAAATGTTAATGAGCCGCGTTCGAATCTGGCATAAAAGCAAAATAAGAAATTCAAAATAAAGCAAAAAAAGGCGAAATAAAACCGAAACTATAGCAGCTTAACCCAAATCACTTTAAGATAATCAATTTTGTTTTCCTTCGCTGCGAGGTGAAATCTTTTGGCGACCTTGGCGCCCATTAACTTACATAAAGAATCATCCGGGAGGAAGTTCCTCATCGCGGAGATCTTCTCCTTCTAAAAATGCCAAGTCATTAGGGTAAATGGAGACAAGCCCACCAAAAAACCGAGCAAACCAAGCCCGACGAACTGAGATTATGTCACGGCAGTCAAGCCAAATAAACTCACAACTAAATAAACATTAAACGCTTCAGTTGAACAACGACATACTTTCCCATTAAGGGACAAGATGGGTGCGGGGGAGGGGGCGTACCGCAGATGCGTAATGCCAATTTGTGACATTACTCAACCGGCGACAAAGCCGAAAGACTTTGCATAGGACCATTGTTGAAGTGAGTTTGGCCAGCT


Search Again