CR01061

CRIMIC CR01061

Gene kcc

CG5594

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 Order from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AGGTGATATCCACAGGGCGGAGG

Amplicon 5' Amplicon 3'
TGTGTCCAAATTCCCTCCCGGAGACCCCAGATCCGGGCACTCGGTGTCGAGGAGGATTACCCCGCATTCCCATAGAAAGGCCTCATTTCGTAACCATTTTCAGCTGCATTCCGCACTTTCGGTGCATTTAGCCAGCTCGAGAGCCGCTTTACGGCGAAAAGGACGACTTTACGGCATTTATTTACCGCCCCACGACGACGGCCTGAAAATCCTTGACCTAAATTAATCGGTTACATATTTTTTTTTTTTCTGTCCGAGCTGGCTCAACTTTCGCAGCAGCATCCCCGCCCGCCCTGCCTGCCGGACGCAATTTTTGATCCACCTCCCATCATACCTCCACCTCCGAGTTCTTGGGGCATTTCCCGATTAGGAGCTCCCTTCCGAAACCAAACCCAAATCTCGAGTATATAGGCACACGTCCGCAGACATGTGAATATATACACCGCAGCGGCCACGCCTTTTGGGTTATATAATCCCAATGCGTGGAGCTCCGTCTGAAGAAGGACCATGCCCACTTAGTTCTTAGTTCTTGACCACGTTCTCCTCTAGTGTTACCTAATTTTAAGTGAACATAGTGCAATCTAAAGCAAGGGTTTGAAACCAAACAACCAACGTTAACATGCAAAGTAACAGTGCAAAAGATGATTCGGATGAAATGGAAATAATACCATCCGAACACAATGGTACAGTTCACGAAACCAAAAATGAAGGTATGCAGGGGATAATATCAATTATATAGTATATATGTACATATATAGTGTTCACTACTAGTGCTTAGTAGCTTAATTACATAACGTAAGATATCCGAACTCTATTCAATCCTGTGCATCCACAGACTCAGGTG GAAGTCCAGCATCGACCCAAATCTATATCTGTACGACGATGATTTGGAGACCAGGCCCCATATATCAACGTTCATTTCATCAATTGCCAATTATGAGAACACGATACCAGCGGCCACCGATCCCGATGCAAAGCCGGCAGCTCCATCGGCTCGAATGGGTATGTTCGCCGCGCATTAATTAACTTGCTTGTTCCATCTACCCCCATATTGAAAGGCATGTGCACAATGGAATCGCAGCAAACAACAAAGCTGTGGAGGAATGATTGCTGTAATCCCCTCAAAGTGTTTCAGCCTTCACTGTGCGGGCGAATATTATAGAGCTGTTCGAAAGTATGCAACAGTGTGCAGTAGTGTGGCACAATCGAAGGGAATCGCTCCCGCGATTGAGTGCATACTTTCGGGCACCTGCCTAAATGGTTTCATTAAACTGATGACCCCAAGCATCAATCTCTAACGCTCGTTTCAATGTCTCATAAGGTACCCTAATTGGAGTGTTCTTGCCATGCATTCAAAACATCTTTGGTGTCATATTGTTCATTCGGTTAACATGGGTTGTTGGAACGGCTGGCGCCGTGTGTGGATTCCTGATTGTTCTGACCTGCTGCTGTGTGGTAAGAGCGTCCTGCTGCTGAGCCCTCCCCCATTTGGCCTCACTCCAAACTCCTCTTTGCAGACCATGCTAACCGCGATCTCGATGTCGGCCATTGCAACGAACGGGGTGGTTCCGGCGGGCGGGAGTTACTTCATGATATCACGGTAATTACAATGGCATTGGTAGGAGGTAGTAGTAACTCTAATGGTGCCACGATTAACATCAACAGATCCCTGGGCCCTGAATTCGGCGGAGCGGTGGGAATGTTGTTCT


Search Again