CR01055

CRIMIC CR01055

Gene CG15615

CG15615

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 multiple bands OK81165

Images

Construct Sequences

sgRNA sequence
TCTGCTCGGTGTGCTCTGTTTGG

Amplicon 5' Amplicon 3'
GCGAGGGGAACCATTCTGAAATGACCACTGGCTTCCAGATCTTTTTCCATCCAGGCACCCAGATCTCCTTCCAGCCGGGCACCCAAATCTGCTTCCATGCCTCCTTCCATTCCTGAAAAGAGTTGGAATATTTAGTTCGGATTTTATTTCTGATTAGTATGATAAACATACCAATTTATCGGTCCAGATTTCCTTCTTCGCTGGCTTCCAGTACTGCTTCCATGCCTCCTTCCACTCCAATTTCTTCTCTGGCACCCAGATTTGCTTCTTGGCTGGCTTCCAGATCTTCTTCCAGTGCGATTTCCAGACCACTTTCTAAACATTCGGGATTTAAGTGTTTAAATAACATCCTTAAACTTAAAATATATTTTACAACCAACCTTCTTCCACAAATCGTGGCTGGTGTACTCCCAACCTTCGTGATCCTTGCCCAAATATTTTTCTCCGGGAATGCCAACCTTTAAATTAACATGATTCTTAGCTACATGCACTTAAAGGTAAATGTATATTCCATTATACCTTGACTAGTTCTGGTGTCCAGATCTGCTTGTAATCGGGTACTTGAATATCCTTCCAGGCTGGCACTAAAATCTCTTTCCAGTGAGGAACCTAATATACAGAGTGTATATAGTTAATTGCACTTTCATTGAGAGTTAAATTTAGAACATACCCAAATTTGTTTCCAAGCTGGAACCTGTATTTCCTTCCAGCCGGGCACTTTCACCCAATGTGGCTTCCAGATCTGTGATAGACATAATTAAAATTGTACTCAATCCCTAAATATATTGATTATTTATTTTATTATAGACTAAGCTATTTACCTTCTTCCATGAAGGATTCCAGATTTGTTTCTTAGCCGGATTCCAAATTTTCTTCCATCCCTCCTTCCAAGTGACCTTCTTCTTCCAGTACCCGGGGTCATGGTGCTCGTGATGATGTTCGTGATGTTCGATTATGTGCTCGTGATGGTGGTCGTGGATCAGGTCATCGCCCAGACCCAATCCCAGATCGATCCTCTGCTGAGCGACACTTTTGCTATCCACCTGGGAAGCTGCAGGCTGCTGATCCACCACAGCCTTGGATTGACTGCCTCCGATG CCCAACTGAAATGAGCGTGGAAGTTTATGCTTGTAGTTAATAGATACAAATCAAAAGACTGAGACAACGAACTCGGGCATGAAGAAAGCTTGTTTAAATTGAATTCGCAACGATCATGTTAATGAATTCCATATTCTCCAAAGAAAGGTGAGTGACTGAAAACCAGTTTTAAGTGGGTCAGAGTCTGGCATTGTTTTTTGGGCGACCGACAAAGAAATGTTGCATAACCCCAGATGTTTATAATTTCATACAATGCCTGACCTGGGTCAAATGAGCTAGCTGATGACAAATCATGCTGGGCCAAAGACTTTTCGGGTCTGGGCCCTCTTTATTTGGCCAATTTGTTTTATTATGTAAATGGGTTTTTGTATTATTCGGATAAATATGGAACTGTTGGATAAATGACGCAAGCCATCTCTGCATTTGGAGAATCCAACAAGGTCAGGAAACGCCCTCGTGATTTCGCAAAATTAGCCCGATTTGTGGTTACAATTTCAAAAGACCCACAACCAAAACACAATTCCAATCAATTTGCGCATAAATGTCAACGAGACCCGGCCCGATTATGAAATGGAAATTAGCGCCAGCAAAAATTATCTCATCGGATAGTGCTAATTGTAGCAGATCGATCGTGTCAGCTTCCTCACTTTGGGTGGGCAGTGAAAGCTACGCAGACTGGTTTCGCCTGCAGTTGGATCATCGGTCGTGAGGGAAAAGAGTTGGCGACTCCGCACTGCACCCCACGGATATATACTATATGTATGTATATATCTATATAGTATGCCCCCTGGTCGCTAATGAAACGATCGCGATTTTAATTGTTGACAATGTGGCTCATTTGTCGGAAGGGA


Search Again