CR01048

CRIMIC CR01048

Gene CG31871

CG31871

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AGGCACAAGCCTGAGAGGATAGG

Amplicon 5' Amplicon 3'
AACATTTGTCGTGTGGTGCGAGTTTCAAAACATCCCGAGATTGGCCAACACGCTGGGCGGGAAAATCCAGCTGGCGGCAGCACTTTGTTGCATTTTGAGCATCTTGCAACGCCTTCGCGTCGCTTCGCAAATATTGGCCGGCTGTTTGGCCAAATGTGTGTCAAGCTAAGAAAAACAAAAACTTTGCCGGGTAGCATCGCCAGCAGCTGTTGCAATTTTTTCGGGGCTTGGCCAAGTCACTTTCTGCGGCTTCTCTGCGCCCCGTTCGCACGTTCATTCATTCTCGAAACAAAGAAATTACGTAAGACAAAAGGCAAGGAAATTGACGAAAAAAACACAAAAATAAAGCGAAAAAAAAAACAAATAAACCAAATTTATGCTTAAACATTTGGCAAAAATCGGCCGAATACAAAACATGCAGAAACGGAGCAGGAAAAAAACATTTCGCTGGCTTACTTTGCGTACCACTTCCTCATGTTGTCCAACCAGCCGGCAAGTCAATTGGCCAATTGCAGTGTTTATATTATTTTCTGGCCAACAACAGGAGGGTCTATTCGCTGCCAAGGTTAATTAAAATGCCAGTCGGCCCGCAGAGCCTCTCTTTCTCTAGCTTTTTCACTCATTCCAGCTGATTTTCAGTTTGTTTGCTTCGAAATTTGGGTAATCGCGTGTTTATAACTTAATTTCAACAATGGTGTTATGAGTTTTTCTTATGGCCACCCACTACCCGACCGGCTTACATAATCGCACAGACTTATCAAACGTATCACGGACTTCTGAAAAACCTATAAATTCATTTGCCAGCAGGAAGAAATGTATGCTGTCATACAGTGCGTATGCGTGATACGTGACTGGGTTTAACTATGGCGATGTGCTTATAGAGGTTGCCGCGTGTATTTTGCCTCACCTGTAGTTCCAATAAAGCATCGCCAATGTTTTGCTTTATAGTTAGCCCGATACTTTTGTTTTCATCGGTGTCAATAAAGCGGTTCTATAAGGTTCTGTAAGCCAATATAGTGGCTAGAATGTCGTTTTACCTGTCTGCCTCTGAAATAATCTACCACAACTATTTCACTTAGCTTTAACTTCTCTAAGATGGAAGGGTTAACATCCAGGC ACCACAACAGCTTGTCTGGTAACTTTATTAACTTGTTGATGCTGCAAATTAAAATTCATTACTTCCAAATGACTGTGGTTAAGGCCAGGCGATTGCCTCCTTGATGACGATAACGCTGCCAGTGGATACCGGTGGTCTCCTCCACCTGCCCTTCCATTTGAACTATGCAAATTAACGGGGCAAAAACAAAAAGCAGTATGGGCAGGTGGAACGTAGAGCATGGCAACTCAATTTCACACTACCATGATTTGCACTTCTAACACCTTTCTCTCAATCTGACGCATTTTTTTCCTCCATTTTTTCGCTCTTCCAGCCCAAATTAATACGCAAATATGGATATCCATCGGAAACCCACACGGTGGTGACGAAGGATGGCTATATCCTGGAAATGCATCGCATTCCCAAGAAGGGAGCCCAGCCGGTTCTCCTCATGCACGGAATTCTTGATACCTCTGCAACATGGGTGCTTATGGGACCCAAGTCAGGATTAGGTAAGCTATTTTACAGGGTTAAAATATTTACTTTTACTCAAAAAAAAAGGACAATATCGTTTGGCTCAAAAGTGATTTTATTTTAACTAAATTTTTGGCTTTAAAAAACTGTTCTCAAATGAGTAAGCAATTTGAATACTAACTAAAAGAAAACATTTAGCGATAACTTCATCTAAAATAAAATATTATCAACGTAAGATTGAATTATTTAAATATATATATACTTCGCATCGATGGTTTTTGCAATTTTCAGTACTCCTTTTGTATCATATGCAGAGGTATTTAATAAAATTTCCAAAATCTATATTGAGTACCTGCCTGTGATGTTAATTAATCAAATTAAATATGTTATCCAGGCTACATGCTCTCCGATCTGGGCTACGACGTGTGGATGGGCAACTCTCGGGGCAATCGGTACTCCAAGAACCACACCAGTTTGAATAGCGACTATCAGGAGTTCTGGGACTTCACCTTCCACGAG


Search Again