CR01041

CRIMIC CR01041

Gene Tep4

CG10363

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATTGATCAGCGAAACCATTGAGG

Amplicon 5' Amplicon 3'
GATCCCGCGCATTATAGCCTTATAATATCTGTGCTCTTATTTCCCATCCTTTTTGCCCTCATTTGACCACCAATCCAATCAAAATGCGTCGCGCAGACGCTTTTGCTGTCTCGCTTTGTGTGATTTTGGCCTTGCTGCAGACGATGGAACCGGTAAAAGCCGAGGGGTAAGTCCATATACCACAAATACTATACTATATGATCGGATCGATTTTAAAACACATCTACGGTTAGAGTATTAGTAGAGTCGGGTTAGGAATTCGCAAAAATATAGGCGATAATCAAAGCCAGATATCTAAAACTATAGTTCTTTACAAAGCTGGCCTATAAAACGTATTGTTCTTACTTCGGTTATTCGGTTGATAATTTGAATAAAAACTGATGGCTAAAAATTTTAACCATTTCCCTAATACGCTAGTGGTTGGATTCCCGTCTCACTCGAACACTTAAACACAGATTACTGCAATCCAAACTATATTATCTATGTTTATTACTTATTACCACTATTATATTCACAGTCACTGTATGGCTGTCGTCGAATATTTCAATTAATTAGGTATGCATATATGTATACAGATAGGGCCGTTTTTAATGAACATCAAGGTAATTAAGCTGTTATTTATACGCAAAATCACCTATTAGCTTAATTGTTTATACCATCTGGTTTGTCCTTGGATTTATAGGAGAGTTTTTTTACGGTTTTTACAAATCACTAACCTAATAACATTTTGCTCTACATTTTTCAAATAGTAATTTAACTTTTAGATATATAATTATGTATATAGCAAATGTTAAACATCGTTCCTTATCACACCTATAAGATTAAACACTAGACTTCTGTCCACGTAGTGACGATGAGCACCTAAAAGGGTGAATTTGGGGAAATTCAATAAAATTGAAAATCTGGTACGATAGTCCGATCACAACTATTCACTCACTTCAAAAATATTCAGAATTTCTTTTTTAAAGAGGTTTAGTTACTCCGAACTAATATCTGGTATTTAATTTTTGAGTTGAAGGTGCCATCGCCACTTTAATCTCACCTTGTTGAGGGGTGTTTTATTTTCTTCATTTTTGTTGAGCTCAACTTATGATGCTAATTGAGTTTCACTGTAAGCCATTTTGAATATGGATTTTTATATTTTTTACTCAAACAAGAGGATCACGTCACATACTTTGTTTGCCT TGGTTTCGCTGATCAATCTTTCACACGATCTTAAATCTGTACTTTTTCCTGTCCCGCCAATTATTAGTAATTAGAAACGAATATGAAGGTGGGTTATGGAACACACTTAAAAATGTCATAAACTTGAAGTCTAACATAAAAGGCTGGAACAAATCTAATCCAAAAAAGTTAATGATGTTCAGGCTAACAATATTGGTGTACGTGATCGGGGACTGTAAGTGCGAGAAAGATTGCTAATCGCAAAAGCTGGAATTATGTAATCTCTAAGCCGGTTTCATACTTTTCAGTAGAAGATCAGGTTCTGGGAATATTATCCGTTATATATATATATACATATATATTTCATCATTTGCTGTCACAGATCAAAAAAACCATAACTCAAAAACCTAAACCGAATCTTAGACTGCCTTTTAAAGATTGGGAACATTATCAAGTCGAGGTTAATGGTTTTAAGTTTCATTTCTGTGTTTCCCTAGAGATTAGACAATATACATTTATTTTTGAATTCTTAGAGCATGGTCAAGAATTTGATATTGATAATTTGAATATTGATAGCTATAGTTACTATCAAGAAATACAATACTATATATTATACAAATACAATACTACAAATATTTCCAAGTGGATATGTGTATGTTTTTTTCTCTTCTTGGAATTTTTTATGGCCGAATTGTTATTTGATTTTATTTTGTTTTTCATGACAATAATGTTGATGTTTTCTTTGCTTCCAGCAAGTACACCATTGTGGGTCCCGGAACCATCCACTCCCACCGTGACTACAATGTGGCCGTGGCTGTCCATCAGACCAAGGAGCCAGTCACCCTGAAAGTGGGCATCACTGGACCCTCCTACAACAAAACTGAGACCGTGGAACTAGCCACTGCCGGTGAGTTCAAGCAGATCACCTTCAAACTGCCCCCATTGGAGGCGGGTGAATATAATCTGACGGCGGAGGGCGTCAAGGGACTGGAGTTCAAGAACTCCACCAAGCTGAACTGGGAGAATTTCAAGCCATACATTAAAATCCAGACCGATAAGGGAAAGTACAAGCCCGGTGA


Search Again