CR00990

CRIMIC CR00990

Gene ND-PDSW

CG8844

Information

Donor Location Cytology FBti Stock number
pM37-p12L:3466680..346670223F3FBti020687683239

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK AAACAGATGCTTCTTACCGCGCAGAC CAAGGGATTCAGACGCAAGCTAATGG

Images

Construct Design Sequences

sgRNA sequence ATGAACTATATAGTAACGGACGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CCCAAAAGTGAGACTCCGCT GCATTTAAGGGCTGCCGACT TCTAGTCAAAGCGGGATCATGT AAGCCGCTGGTCTCGATTAG
 
Amplicon 5' Amplicon 3'
CCCAAAAGTGAGACTCCGCTGGCCAAGTAAGTGCCTTGTCGGTCCGACCCACGCCACCTGCTCCGCTACCTGGTGCCTCCTGGGCTAGTTACCTGCAATTCCTCGCCCGTAGGAGCTCAGTTACACATGCTTAGACCGCGTTAATCCTCGATTTCATTATCTAATGGTAACTTTACTGGAACGCTTTTTGTTGGTTTCACTTTTGTGGCTTCGTTATCACTATGTTTCACGTGCAAAAAAAAAAAAAAAATTGGTTTACGTTTGAGAGGTCTCAAGTCATTGTTAATGGTTATGCTGCACACTGTGCAACAGCGTTGAAAACAATAAATTAGCAACTAAAAAAAAAAATTACCCAAGCAATATTTTGCTGAGCGAAGCCAGTGTGACCGCAGTGTGCCAGTGCGAACATGCTAGCTGCAGTGCGGCATAGGTGTGACCACTACCTCGAACAGCTGATTTCAGTGCTCTGAGGAATTTTCGCAGTTACGAACTGCGGTCCTACAACAAATTTTAACACTTAGTTTTTCAAGTAAATATGGTTTTTTAAGTATTTTCCGTCAAAGGAAAGCGGAAAACCTTGGAAATTATTTACTAACAGCTCTTCCGCTTACGCCAGGTGGTAGGAGAGCCAGAAAATGCCGGAACCGCGCAGTCCGATGGCCAGTTTTGCCGAGTCGGTGCTGAATGTCATCGATGGACCCATAACTTGGTTCCGTGGTATGTAGTCCACAGGGATTCCCAATGGCCATGGTCATGGGAGTCTCCAGATGCTGCAAGTTTGCGTTTCCTTTGGCCAACGATCGGAAAAACCGGACAAATTCCAGACAATTACATAATGACATAACCTCAACTCGCAGTCCATTTGTTTTTGTTTACACTGTATTGCTGAAATGCTAAAATGTTTATAATCAACCGTTTTAAGTAATTTCTAGCTAGCGCAAACTAAATCTCTTAGAATACTAGTCGGCAGCCCTTAAATGC TCTAGTCAAAGCGGGATCATGTTTTTCAACAGAAATGCATTACAGCTAGTATATTTTATTAATGCGCCTTGTGTTAATCCCACAGAGAGCATTGTGGAGCCGAACCAGCAGAAGCAGAATTGGTACCACCAGCGCTTCCGCCGCGTTCCGACGATCGACCAGTGCTACACGGACGATGCCGTCTGCCGTTTCGAGGCCGATCAGCAGTTCCGCCGGGATCGCATGGTCGACAACGAGATTGTCAACATTCTGCGCCAGCGCTTCGAGGACTGCACCCTCTACGAGGCACCCGATCACATGGTCAAGTGCAGGCCGCTGATGGATCAGTACGAGAAGGCCACCGAGAACTGGTTCATCAAGTGTGAGTGGAATCCCTTACCCATCTTCTTTAAAGTTGTATGTGATATATAACGAGATATAACCCATTATAGATGGCGACTTGGGAGGCTACGCCAATGCCAAGACCGCGTACATGAAGCAGAAGCATCGTCTGATCTGGGAGCGTCGTCATGGACCAGTGGGCAGTGGCATGAAGGAGGAGGCCGCCCATTAAACTCCGCTTTTATGATGATGTTTTCTAGTTTCATTATCCGTTAAAACAAAATATACACGCCGTAAAACGATATTCCCAAGGATTGAGCTTTCTTTCAATTGTTTCAGTGTAAATTATAAGGTAAGAGCTACTAGGAATTATTTATTACTACAGCAGTTTCAATTCATTTGTCTATTAGTTGCATTTATTCTTAGTCATGTTTTTCTTAAAATAAATATTAATATTGGCGTTTGATATAGAATTTTGGCTATAGACTAGCTTAAAACTAATAGTTCTCAAGATTAAGAGCCTTGGTTAAGTTGTTCCAGTGAGTAAAATAAAGTTTTTGCCTGCGTACTGCAATAAGTTTACAGAATATAGTGATAAATCATAAAACTCACACTGTAATTCTTCAGACTTTTTCGAAAATTTAGACAATTTCAAAAAGAGTTCCATAATTTCTCATTTTTTAAAAAAAGGAATGCACAGTCCATAAATCATTTGCTTTTCTTAAAAAAAGAAAAAATTACACTTTTAGAAATAGATACCAATAGATAGGCAATAGTGAAATTTGTTCAAGCTTTCTAGAATTACGCTATCTTAGATTACTTTCGAGCTCAGCTAATCGAGACCAGCGGCTT
 

Search Again