CR00973

CRIMIC CR00973

Gene l(2)k05819

CG3054

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CGTGAGCATGCAGGCAAGCGTGG

Amplicon 5' Amplicon 3'
GTTCTCCACTCACCCACGAGCACTACGCACAGTTCTGCGGTCATGTAACCGCGGTGGCTATGCTCGACAAAGATCTGGTACCTGTGACTAATCGGTATGCGTATGCACTCATTGAGTCCAGTAAAAGCTTTTTGCATGGGTACGTAGTTCATTGCCATACTCATCGTTAGTTTCTGTCTAACCAGTTATATATATGGTCGTTTGCATCGACCGCAAATATACTACTTATATAGTCTAATGATTTTCTCCAAAATAATGGTATTGAATACCATTGCATCCAAAGCCAGCCCGATCAAATTAGTCTTTTCTTTGGGTATTTTTGATTTTTGAATCCAATTGGACGATTTCCCTACAAAACAAGCACAAGAGATTGGTAAAGATTTAAAAATTACAAGCGTAAGAAAAAGTATTTTTGATTTCCAGTAACTTGCTATTCCTTAATCGTTTTGCTCTATAATTTCCCATATCATTCAAGCCTAAAAAGTAATTGCAATGTGGACATGTAAACCTTGTATTTATGTATTATTCTACCTCTATTAATTTGTTCGTACTCGTAAATCGATCTCCTTCGCCTCCCCGCCCCATCCCCATTGGCATGCTATTTTAAGTAACAGACATTCAAGAACGCTTAAATATAGTCGCCCCATTCCCGCCACCGAAACCGCCCCATCCGTCGACCTCCGTCCGCCACGCTTGCCTGCATGCTCAC CACCGACGCATCCCATCCAGCGGTAGTTGGAACCAGTTCTAATCGGTTGTTCTCTATAAACAGACGCTGCCTTTGCGAACTGGCCAAACAGATTGGATTCACCGACCATGCCACTGATCGGTTCGCGCTGGAGGGTCAATTGGCTAGCTATCGCCACTTGGTAAGACTCGGTGACGTTGTAAAATAGTATTCTAGTTATTATTTAAAATATCTCCATTGCAGCAACCTGATGTTGTGCGAAGGGACATTCGTTTCGCCCGGCAGCTCCAGCTGTCCTCCAAGGTGAAGGTCCCATTCCCGCACTCTTTGTCTGTGGTCATGCGCGAGAATCCAGGCGGCTATTTATCACTTTTCACCCAGGGAACAGCAGACATTATACTGGACTGCTGCGATGACTTTTGGGACGGCATTGATCTGCGACCATTGTCCGCACAGGATCGCAAGCGTGCACTGGACTTTTATCAGCGCAGCGCGCTGACGTCCTATTGTACAGCGTTTGCCTATCGACCTCTAAGGCACGGCATCCATGGAGCCCTTAGCGGTCCTCAACGGAGTGGAGGTGACTGTTTGTATCTGGAGCTACCGCCGGAGTCAAAGCTGCGCATGCAGCACGTGGACAAGACCCATTGCGACTTCCAGGGCGGACATCACGTCAAGCTGAGCCACAGCATTAGCACGGACTCATTGCTATTTTCGGAGAACAAGGACGAGGAGTGTAACGATGTGGAGGGCTGCTTCGAGATGCAGTGCCATCAGGTATTCATCGGCATGGTGACAATGCAGTACCAGGCGCAAAACGATATCGTACGACTCGTTGAGCATCTCGAACAGGCCTGCATACGCTTTGTTCACTTTAGCAAAGAAAACGAACTGCGCTCGCGTGTCTTCTCTGAGAAAATGGGTCTAGAGTCCGGATGGAACTGCCACATCTCGCTACTGAGCGAACCTGAGCCGGATAGTGAAAAGGAGCGGATAAGTGCCAAGCCAAAGGAGTTCCCGGAAAATATTGGTAAACCCCAAGCCACCACCTCAACCACTGCCACCACCACTACAACAGACCATGAGAACAACCATCATCCCAGTGCCAAAGTCATGTACATATCGCCCCCCGCACCCGCACCTGCCACTGCATCTGTATCCGAATCCATATCTGCAGCTAAAACCACTGAAATTGTAGGTGACGGCCCAG


Search Again