CR00961

CRIMIC CR00961

Gene wbl

CG7225

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CTGGATTGCAGCCTAAAGCTTGG

Amplicon 5' Amplicon 3'
TGAGTGAGTTGGCCAAAGCAGCCAAACAATTTCAGCTGAGCGAAGCGTAAACTGGCCCAAAACTCGAACTCGAATACAACTTTACCGCTCTTCTCGCGCTCGTTTTTAGCCAGTTTGCGCTGACAAACGGCAAGAGTAGGGTCAAGTTCAGAAGTCTCTGGTTTTTGCCACGAAGATGATGCATATTTTGGTGACTCTGCTCCTGGTCGCTATCCACTCGATACCCACCACCTGGGCCGTCACCTGCACGGGCTGCGTGGATCTGGATGAGCTGAGTTTCGAGAAGACGGTGGAACGATTTCCCTACTCCGTAGTGAAATTTGATATCGCATATCCGTATGGGGAAAAGCATGAGGCCTTTACCGCCTTCTCCAAATCTGCCCACAAGGCAACTAAAGATCTGCTAATAGCCACCGTGGGTGTCAAGGACTATGGAGAACTGGAGAACAAGGTGAGTTTTATTTTATGGATTACCTAGGATTTAGATATGTGGTAATGATTGGAAAAAATGTGGTTTCTGCTCTGTTCATTTGGAATCCTGGATTGCA GCCCTTCTAAAGACTCTGTGCTATTTAAATTATTTAAAAGCACTTTAAATTTGATTTATTTATTATTTCAACTTTTTAATCCCAATTTGCAGGCCCTGGGCGACCGTTACAAAGTCGACGACAAGAACTTCCCGAGTATCTTCCTGTTCAAGGGCAACGCTGATGAGTACGTCCAGCTTCCTAGCCACGTCGACGTAACGCTGGACAATCTGAAGGCTTTTGTCAGTGCCAACACACCTCTGTACATCGGTCGTGATGGCTGCATCAAAGAGTTCAACGAAGTGCTCAAGAACTATGCCAATATCCCCGATGCAGAGCAACTGAAGCTTATCGAAAAGCTGCAGGCCAAGCAGGAGCAGCTGACCGATCCCGAGCAGCAGCAGAACGCCAGGGCCTATCTGATCTACATGCGGAAGATCCACGAGGTGGGCTACGATTTCCTGGAGGAGGAGACCAAGCGACTCCTGCGCCTCAAGGCCGGCAAGGTCACCGAGGCCAAGAAGGAGGAGCTGCTGAGGAAACTGAACATCCTGGAAGTCTTCAGGGTTCACAAGGTCACCAAGACAGCGCCGGAAAAGGAGGAACTGTGAACTTGTTAGATCTTTAAACAAAATTATGAATACTTTATGATATTTATAAATGTCGGATCTCGACAGAAACATGTGAATGTACAATTTATACGAATTATAAGTCTATCATCCAAATAAAGACAGTTTTTTATGTTGAAATGCCTTGTAGTAATTAAATCAAACTATTTTATTTCCACTCCTCATTGCCAGTTAACAAGTCAGTTAAACACAAATAAGCCTTCAATTTATAAGTCCTCTGGTACATGCATATTTACATTTACATAGAACTTCGTTTTACCATTAATTAGAAAGTCTAGGCGTGATAAATAATCTCCAGAGGGAAATGGAAGGGGTAGTGAAATGCGATGAAAATCGTTAAGTACCACCGTACCCTGCAAA


Search Again