CR00949

CRIMIC CR00949

Gene CG5522

CG5522

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
AATTCTTGCGCAGTGATTCGAGG

Amplicon 5' Amplicon 3'
AGGACAACTGGGCGAATCTGCGCTCCTACCTCGAGAGCCTCCGCCTGCCCTGCATCCCCTATCTGGGTCTCTTTCTCACCGATCTGATCTACATCGATTTGGCCCACCCACATAAGGGCGGATTGGAGCCAGAGCAGCGTCGCAATAAGATGAACAATATATTGCGTGTAATTTCGAACTATCAACAGTCGAACTATAAGCATTTGCAGAAGCATGAGGCGACACAAAAGTATTTGACTTCGATAAGGTATATAGAGGAGTTGCAGAACATATTCGAGGAGGATCAGTACAAGTAAGATTAATCTTTTGAATCCGAGCTGTTTTCTTATCTAAAAATAATGCTGTTATAATACTCATTAACCTTTCAGGCGCTCTCTAAACCTGGAACCTGCGTCGCCCTCTGGACCCAGTTCTTCGTCCTGCAGCTCAAAAGAGTCCTTCAATGTGGAAGTAGTTACTCCGGCCCTTGGATGCCTAAATCTCTCGCCGGCCAAAACCATTGGCTCCATGCGAATGGCAAGCGGCACAAAATTTGTGCCAGGCCATCGCAAGTGTCGCAGTCTGGGCACCAAGTAAGTAAAAGGAATCCTACGTTTTGAGAGCCAACACTTGGCTTCCCTTGTTAACCACCTGTTTGAAATCCACCACCTCGAATCACTG ATCACTGCGCAAGAATTGGACATTTGTACACTGGGTCCTTATTAATCGTTTAAATCTCTATGTCTCTCACTTCTACCGTTTTGCTTTTGTCTTATGCTTTCGTTTTGTGTGTGTGTTCGTTAATTGTCAAACATCCGCCTCTGCCCAAAACGAATGAAGATTTCGCAGCAGCAGCCTGCCGCGAAACTTTGCCGAGAAGTGCCAATGTTGCATCGTCATGATTGCGCCGGGCATCGGCACCATCTCCAACAAGCGTTGCAGATGCCGTCGGTGAGTCCAGAACAGAGTCCTGTAGCTAGGATATGTGTGTATTGCCAGCTTGATACTGAATACTACTGATTCGATGCGTTATCCTCATTTTAACATTTGATGTGTTCAGTTATCGTCTCCTCATTTTCTTTTCTTTTGCACGGACCCGAGTTGAAAATGCTATGATATACACAAATACACGACCCAACACTTGACTCATTTCATTTGATTTTGATTTGGGAAACCATGCATTACTCACCAACCTTACGCACACAACTTCCCCGAACATATTAGAAGGTTCTATCGCATTTATTTTAAACAAGAAACCTTAGTCAATTCTATGCTGAGAATAAATCGATATAACCTACAAATACGAATCGCAGTTCACCCTTGTTTGCCTTTTTGCTATTTCATTTCTTCTCATTTGTATGAACAGCATGAATGGCTCCAACCCGCAAGAATATCTTGACTAAACCATTTTCTCCTTTTACAGCATTTTTGGCAAGATTGCAACGCACAACCAC


Search Again