CR00946

CRIMIC CR00946

Gene Cyt-b5-r

CG13279

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATTATGCCCCCACTTGTATTCGG

Amplicon 5' Amplicon 3'
ATGATCCAGGGTCGGGAAGAGATGGTGGAGCACATGGTCACCAAAGTGGGTGAGCACCAGGAACTGCGACCACTTGAGATCACCGCGGTCGATAATCGTGTCCACCTGGAAGAGACCCCAGTCACGATCCTCACGATTGGCATCACCCTCGTGATAGATTTCCGGATCGTGATGCGCCGCATTCAGACCAATCAAGCAGAAGCTAAAGCTGGCTATCGACGTCATCGCGAGCCACTGGCGCACGCAGATCCAAATGCCTAAAGATCCCCCGGTTCCCAGGTATATGGCAATGGGTATAGTCAGTGGCAGTAGGTCGTGCCAGTAGAGGATGTTGGTGTGGCGCAGCGAATAGAAAATACTGCAATATCAATCAATCAAAAGATCACTGATTAGACTTTGTTTACGATCACCGCCTCGATCACACACTCACCGAGTGCCCATTTGTATGAAGAAGGCGAGGGCATAGGCCACCGGCTCCGTGACCCAGGACACATAACGCATCAACTTGCTCTTGATGTGCGGATTGGGCACCCAGCACAGCAAGGGTTCGAACATCGAGAGTTCCAGATCGAAATACGAATTCGGATAGATGTGGTGGGACAGAGCATGGGACACACGCCAGGCGGCAAAGTTCATCATGCCCAGATTAAAGGCGTACATCTGCCAGTTGTCCCGACGATGAAAGTAGTTGTGGGACACGATCACCGTCCAGCAGAGGGCCACACTCGCCAAGACCAAAGCCAAAAGGCTGTTGTATTTGGCACTGGCAATGCCCAACAGGTAGAGCGACACAACGAGACCCAGGTGAATGAGCTAAAAGAAATGTATATTAATATATTATAAATATAATGATAAATTTTAAAGTTATCATATTAATTAGGGTTTCAGCGTGCAAATAATTAAATAATATAATCACACAGGCCGCCGAATACAAGTGGGGGCAT TATTAGGGCTGCGACACGTGAAATGTAAGATTAGATGTTTTTAGTTAGTAATAAATTTATTTATGAGCCGGCAGGTTCAACTTCCTATCAATAAGTAACTGATAAGAATTACTTAACTGATATGAAATGAAATCTAAGGCACGCCCATTTTCAATAAGGTATTTTTTTTTGCAGATTAACACTCACATCACTCTTCTTTTTCGGCCGCTTGTCTATGGTCTTTAGTTGCTCGCGGACTCGCTCCTTTAGCGTCTTGTAGAATCCGCCCTCCTCCAAGGTCAGTGTGTAGATTCTGGGTTCAGCCGCATCCCTCACCTTGTATTTGGCGATCATCTTTTCGGGAGCCGTGGTCAGATGATGTGCCTCAAAGGCTTCGGTGATGTCGGTGCCCTTGGTCTCACGAATCCAGAAGGGACCGCCAGGATGCTTGTCAATGAACGAGGTGAAGTCATAGATGCCATCGTTGATGCGCCACAGTCCTTCGGCTCCATCGTCCTGCCGTTTACCCTTTTGCCAGCTGTGTGTGGTGATTAGGGCCGAATTTCGGTATGTTGGAAACTTGGTGGCAATGCCACTCTTTTTCCACTCCTCGATTACCATATTGCCGAGTCCTTTTGATCCTTGACGTCTGTGGCACAAACTTTACCGATCCGAGCACCTTTCCGCTGGGATTCCAACGACTAACTGAAAGGCACCGGCAGTGGTCCGTTTATTTTATGTGTAGCGCAAATCTCTTTTGATTATATAAACCGAAAATCGAGATTTCCAAACAAAACGTTTCCATTTTGATAAGGCGCCGG


Search Again