CR00938

CRIMIC CR00938

Gene Ced-12

CG5336

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79366

Images

Construct Sequences

sgRNA sequence
GGAAGTTCCTCCCTTATGATGGG

Amplicon 5' Amplicon 3'
CCCGACGATGTCTTGACCAAAAGAGTGCTGGTCATGGACATAATACATCCTGCTCAAAGTAGATCCATGTGCTTTACAAAGGGCTACACCCATTACACCGAGGGCACGGGCTCTGCATACACACCGCTTTCGGAGGACGAATCCCACCGCATCTTCGAGTTGGTCAAGGAAATTGACACAAGTAATCAGGATGCATCGAAGTCGGAGAAGATTTTGCAGCAACGCTTGGACCTGTTGCACCAGGTGAGACTGCGCTATTTCACGCCACGGGAAGTTGCTCGTCTAATGAGTTTTCCGGAGAATTTTGAATTTCCGCCAGAAACAACGAATCGACAAAAGTATCGACTGCTGGGAAATAGTATTAATGTAAAGGTTGTCGGTGAACTTATTAAATTGCTGACGATAAAATAAAACAAAATACAACATATTTGCTTGCTTATTTTCACTTTAATACATTTATTAGCTAGGAAATTACTCTGCGCTGTTATCATTAAAATATTTATTTCAAATCCACATAATTTTCCCGCCCAGTGTTGCCTATGCCACAAAACGCAACGGTTGTGTGCTGTGTGATATTCCATACTACTTGTCAATTGGTCACACTGCACTGAATTAAAAAAAAAAAGAATATAAGTTTACGCAGAAAAACAATAATAATTGCAATTATCGCTAATTGAAAGAGTGCCAAAATGATACCAAAAAAGACGACGGTTAAGGATTCACACATTGTGAAAATAGCCGTGGAGCGAGAGGACCATATAGCGCAGTTGATAAATCTGGATCAAAGGCATCCGCTGGCAAGTGAGTAAATAGCGGATAAAAACAAAGATTTTTCGCTTGCTGAGCAGCAGTTTTAAAGAGAATCTGCTTTAAACATGTAAAACAAAGTTCCAAGAAGTTAATAAACCAGAATTATGTTGAAAGTAGCAAAGGAACCCATCATAAGGGAGGAACTTCCAACCA AACTTCCAACCAACGCCCTTCGCTATGTTTAAGTGTTATCGTGATGTCAGCGCACTCATTTCCTCTTTCTCATTTATATGCAAATCATACAATTGGTCAGGAAGTTGCTATTTACAGCGTATTAATGCCGCCTTCGCTTGCAGGTAAAATCCAGGAAATTTGCAATGGTTGGTCCATCAGCGATCACCAGAACTATGCACTCCAGTTCTACGAGCCCACTAACCGAAAGTACGTGACCGAAAAGAATCGCAATGAGATCAAGAATGGCTCCGTACTGCAGCTGCAGTATTCGCCATCCAAGACTGCCTGCGATGCCATGGAGGTGCTGCTCAATGGCAGTCCACAGGAGAAGGCGCTGCGTCTAAAGGAGCTCACTTCCCTAAGCACCGATCACACATTTGCCCTGGAGTTCATCAAGGAGAAGGGTCTCGACACACTCATTAAGATGATTGAGGATGGCGGCCAGACCAACGAAGACATTCTGAAATACAGCCTGGCCAGCTTTGTGGAGCTGATGGAGCACGGCACGGTGTCCTGGGAGGTGCCGGAAAACTCATTCGTGGCCCGCAACATTGAGATCGTGCGAAACTTTCAGAAATATCCTACGAACTGTGGTGAGAGCGCCCTGTCCAACTTGGAGAACATTGTTATGTGCAGCAATAAACATGTGCTTGTTGCCGAGGACATCAAGCTGCAGGATATTCTCCGATTGCTTCAGGATGTCAATTCGCCGGTGATGCGACAAAATGCCATAGCCCTGCTGAACGCTCTGTTCGTCAAAGCAGACGAGGGCCGCCGCAGGACCATTGCTCAAACTATTAGTGCCAAGCAGTTCCGCCTGGCCCTTATCGGCAATGGACTGGGCACAGAGATGACCCACCAGCTGTACGTGCTGCAAACGTTGACTCTCG


Search Again