CR00933

CRIMIC CR00933

Gene dac

CG4952

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79365

Images

Construct Sequences

sgRNA sequence
TTTCCCTGAGACCTGCCCTTTGG

Amplicon 5' Amplicon 3'
GAGTGAGGAGGAACCGGTTGCCAACACTGGCCACACAATTCTCGAACCAGTTTGCAGCTGTCTCCTTGCGTCTCCACAGCGATCGTACATACATACATATGTACATACGAGTATATTTCAATAATCAAGGGATAGCTGAGTTGTTAATTATTGACTTGTGGCCGGGACGCTTGAGAAACAGCCGCCAAAATATGCGCCAAAGTGCGCTAAATGTGCCACTGCCACTTCACTTGCAGTTGCAGTTGCATAAATCGAATCGAATTGAATCGATCCGCATCGAATCGTATCGAGTCTTACCAAATCGAATAGTTAACATCGGGCTAGGAAGGCGTTCCCGGCATTTGTCAGCGAATCCACACTCCCTGGGCTTAACCCACTGCCCCCGGCGTTTTGGCGATCTGGCGTCCAGAAACTGGGGCTAAGCTGCAAATTGGCAAATCAATTATATTTATGGCCAAGTTGCCACCTTGCGACCGCGATGCAGAGCGTGCTTGCCGGCAACTAAATCAATGCAATCCCAGTAACCGACAATTAAATGTGTGCCTGCAACACAATTTCCATATTTGCAATTACCAATGCCGAGTGCTCACAGAGCAGAATGTTAATTGAATCCATAGCCTCAAATTGAATCTCGCCCCTCGCGAACCGCTGCCATTTGTCGGAAAGCCTTAAACCCGACAATATGCATTGGAAATTCCCAGAAAGAAGCCGAGAAAGAATACCGCTTATATGTTGGCGCTTGAAGTTGGCTCGAATTTCTTTCGTTGTTAACAATAAATGTTATTGGAATTTGCATTGAGCTCAACGAGACAAAGACAGCGCTGACTTCAGTCGACTTTCGTATTCATTGTTAAATGACATGCAAATGTACGAATGACATGGCATTCGCCAAAGGGTTTTGAAAGGGGGGCCAGATCCAAAGGGCAGGTCTCA GGCAGGTCTCAGGGAAATGTTTCCAGGCTAATTGTGGGTTTTACGCCCTGTACTTCTCCAAATGATCAAGTACGTCATTTAATGGAAGCCACTGACAATTGGAATCGTAAATTATACAGCACAAACTAGATTTGTTTGAGTGCTCTCAATGTAGGCTAATATTAGATTTCTGCGCTGAATTAAAATTATTGTAATACGTATTATAATGCATTTGTACCCAAATTTGACAGACTTAAGCAGTTCTCTAACATAATTGGCATCATTGGCAAAGAGAAATAATATTAAATTGGCAGCATTGCCAGAAAAAACTCTTCTCCTAAATTTTGCTTGATTGAATGTTGTAGTTGAGAATGTTGTAAAATAGTGTTAGTATTGTAACACACGACATTTTTCAAATATTTAAATGAAAATCACATGGTAATTAGCAATTTTGGGTGGCCTTCTTTCCTCCCCAAGCCAAAGCCATATAATTTCAGCCAGCTACTTGCGATTTCCCCCATGACCAACAACAACAGCCCCATATGTGCAGTGCATTAATGCAGATTTCTTGGCAATTGTTTTTGCATACTTTGTTTTTTCCTCACTCACTTCAATTTCAATTGGCGTGCTAATAACTCATTTAGTTCGCAACAAAAAAACAAAAAACGAACAGCGGGCCACAAAAAATGTAGCTACAAACATGGCACACCAACAATGGATTGGATGGCTAACCAAGATCGCCCCCACTTCCCTTTCCATCAATTGCGAATATATCGCATCTCATGATGCTGAGAGAATACTCGTACTCAACTATGCCGACTTTATATGAACACTGTGTGCAGTTTTGTTTTAGGCTTTGTAATTATTATAAAAATAAATTGAACTATTGTTGCCTCATTTAGATTGAACAGTGAGGCAGCCACAATGTTG


Search Again