CR00930

CRIMIC CR00930

Gene kek3

CG4192

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79364

Images

Construct Sequences

sgRNA sequence
GGGACACGGACGCCCGGTCGGGG

Amplicon 5' Amplicon 3'
ATTCTCACGGCTGACATGCAGGATGCCGGGATCTATACGTGTGCGGCGGAAAATAAGGCTGGAAAAGTGGAGGCCAGTGTGACTCTGGCAGTATCCCGTAGACCCCCGGAAGCTCCGTGGGGCGTAAGAATTATTCTGCTGGGGGCGGTAGCCGCTCTGCTCCTCGTCGGTGGATCCTCCTTTGCGGCCATTTGCTTGTGTTCCCTACAAAGGCGAAGAAAGCTGCGTCTCTGGAACTCTGTACCTCCTGTGAGGAGAAGCGAGAGCTACGAAAAGATCGAGATGACGGCCAGAACGAGACCGGATCTGGGAGGAGGGGCTAGTTGCGGAGGCGGCAGTGCCACGGGCGCCGGACTCTTTCACGATGCCGAGGAGCAGGGCTATCTGCGGGCAGCTCATACGCCACTAAATGACAACGATGCCGGGCAGGCGGCGGCCATCGTAAATCCGAGTGCAGGAAGTGCACAGCGAAGAAATGGAGACTACCTGCACGTGTCCACCCACTGCGATGATGAGGAGGAGGACCAACAGCTGCATCACCACCCACAACAGCAGCCCGCGAGCCAGCACCACCCACATCCCAATCAGCAGCAGCATCAGCAAAGGAAGGGCTCCCAGGGCCATGTTGTCTCCGCATCCGGGGCGAATAATTCAGCACCGCTGGAGGAAACGGATCTGCACATACCGCGCCTCATCGACATCGGCGGGTAAGTTTTCCAACACCGGGCAAAAAGTGTGAGGGAAATTCTTGAAATTAAAAACATGTAAAAATTTTTTGGGCTTATTTATATCTTGAATTTCGTTTGTAGGTTTTGAATATATCTTTAGATTTTATTTAAAGCTTAAAATGTACATCTTATATTAGCTCATTACCATTACCATGATTTCTTCACTCAGTGTATGCCTCGGGTGCCCTTTGTTTCTGCGGTTCTCGTTACTTCGA CGTGTCCCTGTCAAAGAGCTGTCATGCTCGAGTGCGGAACGCGCCCGGATCTCCGTATTGCGTCCGTATTATGGGCAACACTTGACACTTCCACTCTTGGCTCGAGCCTTCTTTTTGAAAAACCCCACGCCCATTGCCCACCAGCCATCCGCCTCCATCTCCGGCGACTATGAGAACGCGCGTGCTAATGACGCGCGAAATATGCGAGCACATCCACATTCAACGTCCTGCCCCCCGCACCCAACCTTCAGCATCCAAGACCACATCCACATCCTCATACACGCGATCCGGAGAAGTGGTTTATTTCGGGCACACTAAGAACTCACTCTGCCTGATTGGCGCTTGTCATGTAAAAGGAATCCTGCCGCGGATGCGAGTACGAGTGCGGGTTAATGGATCTGCGGTGCCGGTTATCTTCATGGACGATGACACTGCCGAATAACGACAATCCGAAAAGTCAAGCACTTAAGCAATATAGGATGCAGGCAATTACTAGGGCTGTGAAAACAAAGGGGGACAGCTCATTCAACTGGGCAGGAATAAAAAATGTTTAATTTCTTTTTTTTTTTAAATCAAAAATCGTAAGCATTCAAATGTAGCCAAAATGTATACTTGGGTATTTCCTTGTATTTTTTTATTAGCAGTTTATAGAGTTTTATTTTACTTTTTTTTAAAATATTTTTTTCCTTTTTCTTGAGTCCCACAAAAATTAAAATGGTATCTTTTCTTCTTTTCCTTTCACCAGCACCGA


Search Again