CR00929

CRIMIC CR00929

Gene CG31650

CG31650

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79363

Images

Construct Sequences

sgRNA sequence
TGCTGAGGTGATTATTGGCTTGG

Amplicon 5' Amplicon 3'
CGTGATCCTCATCGGTGGAGACAAAGAGATGGTCCACCTCGTCGTTGGCAATTGCCGTATTGCTTGGCACAATCCAGGATAAGACCTCATCGCCCGTCAGCACGCCATCGCCATTGGAGTCGTGATCCTTGTCGAAGCGCTCCTTCTCCGTGATCAGCCACTCCTTGTCGTGGTGCGAGGCTGCGTCGCCGACAAACTCCTGGAAGTTGATCTTGCCATCGTGATCCGCATCTTTGTCCTGCATCGTGTGCTCCAGCAGTATTGGCAACATTTGTGGATGCTCCTCGGGATTTTGGAATAAAACGAATTCCTCCAGCGTCAGCACACCATCCTTGTTCGTGTCGGCCGCATTGAACATCTCCTTGTCCTGCTTGATCATCTTCTGCTCATCCTCGTAGCTGTCGTAGTCGATGGTCTCCTTCTTGAAGTCCTCATCCTCCATGGCGTATGTGTCCTGGAGATACTCCTTCCACGTAATTCTCTCGTCCGCATCCTGGTCTATTTCTTCAAATCGATCAGCGGCTTCTTCCTCCGACAGTTTTCTGCAAGTTGTATTATGTATTTTAGTAAAAGCTTCAAATAGTCTATGCGTTTTCAGTTTAGGCAAGCATTTAGACAAAGCATTAGGTTGCTGAGGTGA GGCTTGGCTAACATTGATGCAGTATTAATCAACAGACAACACTCACTTAAAGGACCTTAATATCCAGGCTTTCAACTCATGCCGGTCAATAAATTCGTCCTTATTCAGATCCATCATTTTGATCAATATCAACAGTCGTCGCTTCGATTCGTCTGGCGAAAGTGAGTCGAATTCCTGAGCCTCTTTCGTGTTGCCTTTTTTGTGGTTAAAGAGTAATAATAGCACACACATACATTAGCATTTAAAACTGAATGGAACATAAAACAGCAGCAATGCCATTGACGTATTGCTTTTAGAAAACAATTTTAATGATTTCACTATAAAACTATACAAACTTATATACTTCAATAATACATTTTCTTACAGCATATTCCAATTCATTAGTAAACTATATTTCGACCTTCAAGCAATATTTTTGAGCATAAATGGGTATGTGTATTGACTGATCCGTATTCTCTTGATGCTTGAATGAGTCTTTCCGTGTGCAGACCCACAAAAATAAACCTCAGGCAAGTAAACAAACATATGGCATACACCATAGCATACACAAAAAAAAAGTATGAGTCCTTTTCATAACTAAAATAATACAAAATTATGGTCAATACTCATAATTTCATTGGGTTGGAAAGTATCCTTAAAATAAACTTTTATATTTCTACAAATTAACAACTGAAACTGGAAATTCTATTGTTGTTCTGGCAAAAAAACGTGATTATATTTTATTTGCTTTTCAGGAAATGAGCACTACTTTTATGACCTTCATTGTAAGGAGTCTTTTTCGCTCTTTTCAAAGTGATTTTCTCAAACTGAATATGATCTGCTTTCTCTGCTAACTAGCGCTGACTCACCGATGATGGCCTCGTGATCGAACTCCACGTTGTGCTCCCCATCCTCGCCGTGGTGGTGGGCATCCCGGGGAGCGTAGATGCCGTCCTTGACCC


Search Again