CR00927

CRIMIC CR00927

Gene CG30460

CG30460

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79362

Images

Construct Sequences

sgRNA sequence
CCTAACCCCCGATGCTCTACTGG

Amplicon 5' Amplicon 3'
TCAACCCATACCTTTGCGCTTGATTAACCCATTGAGCTCGTCAAATGTCATGGTTACTTGGGGAAGGCAGATTTGCTTTTCGACCGCATCTAGTTTATCCGTCTTGGGCCCTCTCTTGCGTCGTCTAGCTGGCTGGAGAACTGGCGCTTCCACGCAATCGAGTTTGGCCAACTGGAGAGCATCTCCACTGCCGTTCCGCCTTAGTTGTTCCATGGTCTCGTCAATTTCTATGCAGGATTCCCGCTGAGTGCGCTTGGAACGGCGCAGTGCAGATCGTTCCCTGGGCGGCGGCGATGATGGTGGATCCTCATTGAACAGGTTCACTTGGTTCTGGGTAACCGTGGAGTTTGCTTTGGCACGACTTCCTCCTCGCGAGCTGGAGACTTGAGCTTGAGTGCTGAGGATCATTTTGGGGATGAGTGAAGATCGCTGATCGAAGAACTAACTACGGTGTGTTGAGACTACACGACGGTGGCAATAATTGCTATCAAAAGGTTACGATTACGATTACGCTTTACGGGATTAATCAAGGACGACTAAGATAACGCCAGTAGAGCATCGG GCATCGGGGGTTAGGATAACCTATCTAAGAGAAATCTATGGATTTCGGAAAACCCCTACTCACTTATCACTGTGCACGGACGACGTCATCGAATGGGACATCAGGTTTGGTTTGGGTGTTGTCATCTCACCCGCTTCCAGAACCTCCTCGTGGTTACCGGAGTACTTATCCCTGGCGAGGGATCTCTTGGTCCTGTCAAACATCGCGGTCAATTATATAATAGCAACAAAATAAATTGAAACGAGAAAGAAAACAAAAACGTGTGTTAAGTAGATAGATCACAGGGTGTCAACTAAATCCAGGCTTACTTCAGATTGGGCGGCCTGTACTGCTTCCTGGCCTCCAGGCGCTCCTTGGCTTTGCTGGTCTCCTGGCTGTTGGTGGACTTCATGGTGGCCTGAATGGCCTTTTCCTTACACCATTCTACGTGGCGATCAAATGCCTTGGGATTAAAGGTACGATCGCAGTGGGGACAACGATCACAGGGAGGTGCCTTGATCCGCTTGGCCAGCGATCGTTCGCGGACAAGAGGAGCAGCTGGAGCAGCTGGAGCAGCCGGAGCAGCTGGAGCAGTCGAAGCAGCGGGTGCCATAGCTGGAGCCTCCGGTGTCGAGTTAGACG


Search Again