CR00925

CRIMIC CR00925

Gene stum

CG30263

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79367

Images

Construct Sequences

sgRNA sequence
GTCCTTGGCTATCAGGCGACCGG

Amplicon 5' Amplicon 3'
ACTGTACGGTATAGCGTGCGCGGAAAACAGGAGAAAAGTATTTTCGCAACACGGCTTAAGTTTCTTGCCGCAATAACAAATCAGTTCGGGCCGGACAATCGCGCCAACCGCAGCAACTCACTCGCTGGGAAATTCCAGTTCGGAAAGTTGGAAAAGTCCTCGCCAGTCGATGATTTTCCCAGCAATTAATACGAAATAACAATTCAGTTAATTTTTGCCAATTCGAAATGCTGAACGGAACGCCGAATAACGGGGTCATTTACACGGTGGATCTGGCCCAGGATCCCTTCATCGATGGCGACAAGTACTTCTTTAGGTAATTAGCCACGAGATTCAATTATAACTTATCGCTGCTTGTCATCTGGCAGCGGGTAAATAAACGCACTGACCTTCTGGCGGCATTTCGGGCACTCCGATTCCGACTTCAAGAATGTGCGGAAAACTTGCTCCATTCATTTCGACTGTCTCGCAGTTTTGTTTGAATTTCGACCGGAGCGGGTCAAATAAATTGCCGACCTCCAAATTGCGTTTGGTCGTTGGCTCGTGCACAACGGAATTACTGGCCTGCTTGTTCAGGCACATATATATATATATATATATATTATATACACGTGAACTTCTTCTTGAGCTGCGGGCATGGACCCATATAGAAATTGTGTAAGCAAAACTCTCGTGACACATTTTGTTGGGCTGGCATACTCGAAATCGACCCGAAAACGAAACTTCATTATGCCCGGATGAAAGTTCAAAAGCCACAGATTTAGCATTACACGCTACTAACTAACTGCTGCAACTGCATTATTCATAACTTTGAGATACTAGATAAACAACACATGCGCCATCCGTAGGCCCACGCTAATGGTAATTCACTTCCGAAGGTGATTATTATATTTCACGCCAGCGAAGTGCGGAAGTGATTCAGGACTATCCCACAAACTTGAACTTTCCAATCATATAGCACTTCCGCCCGCCTGGCACTTGGCCAATCCTCGTAGCCATAAAAGCCTATATCCGGTCGCC AAGGACAATGGGTGGGCAAATTACTTTACACCAAGTCATAATCGGACTTAAAGAAATTGAAGGACTCTCTCGAATACTTTGGTGCTTTAAAAGCAAGAAGGTTTATCAATAATACACATTTAAAGTCCGCGTAGAAACTAACACGACAGTTTCCTTAATTTAAGCCTTAATTGTATTTCCCCCTTCCCTCTCCTTTCCTTTCAATCAGGAGCAGCAGTCAGGAGTTCCTTGAGGACAAGGATAATGTCAAGAAGGGCGGTCTGTGCGGATGCTGCTCCAAGCTGTTCATGCCCTGCCGCCGATCCCGCTGCTCTCGTTGCTGCCGGCGCCGTGAGCGAAACGAATCCGCCGAGGATCAGCCTGTCCTGTGGAGCGGCAACAGTAGTGCCACCACGGCCACCAATGTCCAAGTGATTGACGAGACCAAGCCGAAGCGCAAGAAGATATCGGATTGGCTAAAGTCCAGCTGCTGCCGGAGCTGTCGCAAGAAACCAGCCATCGAGGAGCACGAAGCACATCAGGAGGAAGTGTCCAAGCGGACGAACCAGGCGGCTAACATGAGCACGGGACCAAGGACACGAGGCAAGTGCGGCCTCTGTCTGAGCAAGGTGTTCTGCTGTCGATCGGTGAACAGGGTGGATCCCACCACCGGCGACGAGACGGAGATGAAACAGTGCTGCTTCTGCATACCATGTCGTCGAGG


Search Again