CR00924

CRIMIC CR00924

Gene CG2614

CG2614

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79361

Images

Construct Sequences

sgRNA sequence
AGAAGTCTGCTCGAGCTTAGTGG

Amplicon 5' Amplicon 3'
GCAACACACACCATTGACCCGGATGTGATTGACACGTCGCACTTTCTCAAACGCCCGCTGAAGGACGCGAGCGCGCGATGGACCCACGCCGCGGAGCAGCACCAGCAGGCAGCTGTGGTGCAGGGCGCTCTGCTCGTAGTCTGGGCGTGACAACGCTGGCTCCATGCCACCAGCACCGTGCGACAGCATCAGGCCAACGGCCGCACGCATTTACACCGCGCCGCGGCTCTCAAATCCAATCCCTGTCCCAGTCCGGAGGATGCGAGCGCCAGTTTCCTTTGCATCTGCCAAGTTCTTCACAGGCGTTCCATACCGCTGTCAAGTGGATAAGCTCTCGATTGGATTCGATTTCTTCAGAGGAGCCACCTCCTCCCCCTTTTCGAGGTCAGTCAGCGCCTGCTTTCACCACGCTTTTTGCCTGGTTTCTCGGCTGTTTCCGAATCCGCTGCACTCCTTCACATGGGTACCGATGCCGGGTACTCGGAGGAAGTCGAAAACCCCAGGAAATAAATGACTAAATGGCTTTTTAAGCGCAGATAATCGTTTAGCCGTTTGCTTTGGCAAAGAAATTGTCCAATCAGTGCCTGTCGACTAGTCGCTGTGAATGGCACATCGCACAGATTGACGGCAGAAAGGTCACACTAATCTAATCGATGGTGTTGACAATCAGATAAAATATTTGTACAAATATAAAATGGAAAACCAAGTTTCTTATAGTGCTACTTAAAAAAACTTTAATTGTATTACTTTTAGTATTACATTTAGCGAAATAAGCTATTGAATATTTTGCAAATGATCCGCCTCTAACTTATCGATACTTTTTGGCTCCGGCCACACTGCTGAGGGACCATCCACTAGAATGGCAATGCCCCGTACAATCACATTTTGCCGCTTTATTGTTTATATTTTGCATCCTTTTTGTAGTTGTTGAAACCATGAATTTACTGCCCAAAACCCGCGAGGAGTTCGCACAGACCGATTACTGGAACGAATTCTTCAAGAAGCGCGGTGAGAAGGCCTTCGAATGGTACGTAAATGGTACCCACTAAGCTCGAGCAGACTTCTTGGGG CTCGAGCAGACTTCTTGGGGAAGGGAAGAACTCCGAGCAACATGTGTTTTCTTGGCCAACTAAAAGTTGCTTTAACTGCGAAGGTACGGCGAATACCTGGAGTTGTGCGACCAGATCCACAAATACATCAAGCCGGCGGATAGGATTTTGATGCTGGGATGCGGTAACTCCAAATTGAGCATGGATATGTACGACACAGGATTTCGGTAAGGAATCTTCTGTAATAAGCTTTATGTATAAGTAGCATGCGCCTCCTCCTTACATATAACATTCCTTTCCAATATGTATTAGATCTTGATCTTGGCCCTATAAATAACTTTCCCTTGGTATTTTACATTTTCCCCTTAGGGATATCACAAACATAGATATATCTCCCATCGCTGTGAAGAAAATGCTGGAACTGAATGCCAAATCGCGGCCGGAAATGAAGTTTCTGCAAATGGACGCGACAGCAATGACGTTCCCGGATGAAAGCTTTTCGGTGTCGTTGGACAAGGGAACGCTGGATGCTCTGTTTGCCGACGACGAACCTGAAACGAGAGCGGTGGTGGAAAACTATTTCAAGGAAATACTAAGAACCATGAGGTGGGTAATGTGCACAGTCCCAGATCGAAGGTATTCAATGTCTCTATTTATGCATCAGGAACGGTGGTCGCTATGTGGGTATCTCCCTGCTGCAAGAGCACATCCTCAATTTCCTACTGGACTTCCTGCCCAAGCACAATTGCATGCTGAGGATTGTTCACTGCTTGGGGGTGGAACAGGCCAACAAAGAGAAGAATGCCGATGATGCCTTGACGCTGCCTGTTTTCGTAGTCGTCGCTACTAAATTTAAGAGCCTTCCAATGCCAGTGAGTAGACCCCTAGGCAATTAACTTTTTGCATTCAGATTACAATTTGATTTACTTGTAGGTACTCGAATTTGGTTTCGGCAACGACAAGATGCAAAGATTCACCACGGTCTCCGAACTGAATAGCGCAGTTTCATCAGTCCAAAAGGCCGCTTTGGTTTGCAACGGTCTAGCCAGATCCAACATAGCTGGTCACAATGAGGTGATCATGGATCTGCACCGACCATCTGAGCAAACCCCTCGCTATACTATCCACATACTGGATAAGCCGCCAGCTCGCGGCCTGGGCAAATACGCGGCGTTTAT


Search Again