CR00923

CRIMIC CR00923

Gene vlc

CG8390

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79360

Images

Construct Sequences

sgRNA sequence
AACCCGATGTAATCCACAGATGG

Amplicon 5' Amplicon 3'
TAAACTTCGAACGCCACCGACATCATCATGTTTTTCATCTCACCGAATTATAAATAGTTGTGTGTCGTTTGTTGGTGCCATAATGAATTCTACACGGGGCCATGGGAGGGAAAAAGTACGGGAACTGGGCGAAGCATCAAAGAAAAGCCAGCAAAGCGGAACTTTCAAAGTGCCGTTAAAGCTGTTCCCATCTGCTAAGCTTACACTTACACATTCACAGGCTTAACTTAGAAGGCGTAGTGCGCTGCTTATATTATTGAATTTGACTGGTGTTTCAAAATATATGGATCTGATTGGAGAGATAGAGGAGATCTGAATCATTATGTTTTGGGTTCCGAATAAGATAAATAAAAATTACCTGTCAGGCTCTTTCGATTCTCTGAATGCTCAATTTCCACATTAAAACCAAGTCAGACGTGGGCGTTATCAGTTTATTCGTGTTTATTCCTTTTGGAGGTCAACCACTAACGGCTAATTACGGTTAAGAATTGTAAATTGCATGAATAACTAAGCCCAATGCTTTTTATACAACAGGCTCAGTTTTCATGGATCGCAGTCTGGACTCTATTGGCAGCTGTTCACTGGATGTAGACGCCGACTCCTCCGATATATCAGGTAAATATTTATATGGATATTTATGTGGATATACATATAACCAACTTCAATCGCCTTGCA ACATCGGGTTGATTTCCCCGAATTGCAGATACCAGTGGGAGCCTGAACTTTCCAACGCCGGTCTCAGTAAGGGACATAACACGCGAATTTACTGCCAACCTTCGGGAGCGCTGTGTGCCTAACTTGCCTCCCCAGCCTCAGCACAAAACCCCTGCCTACGTTGAATCCAGGTCGTCAGAGCTGGAGCACATGGTGCTGTCACCTGCAATTGTGGAGTGCGACCAAGAGCCGAGCTCCAATGATTTTGACGAGACTTCTGCAGAAAATTCACAAGAAGCTCCCGAAAAGAAGCCCAGCTATTTAAACCTGGCTTGCTGCGTCAACGGTTATTCCAACCTTACCACCTACGACTCCAAGATTCGGCAGGACATAAACAAGTCACGTGAGGTTTCCCCGATTCGTCCCTCCACCAGCAGTCTACAGTACTGCAAACGCAACCACTTTCTAGCGACACCAACTCTGCACAGCATGCCTTCTCCGGCCACCAAGTGCAAACCCATCG


Search Again