CR00922

CRIMIC CR00922

Gene POSH

CG4909

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79359

Images

Construct Sequences

sgRNA sequence
TGTGCCAGTTTAGGTTGGTGTGG

Amplicon 5' Amplicon 3'
TCGTGCGTTTTTCAGCACTGTCTGGACTTAGTATCCAACACTAAAATGCGCTTCAGAAAATATCGACTACGAGGACTGGCCACACTAAAATCCCAACAGTAATAAACACCAGTTTGGGTACAACTTAACAATTATTTGCATTTATTAAATGCAACTATAACCGGGGCACATGTGGTATTTAAATAATTTTTTGCAAATTTAGTGAATTTAAAAAACATGTAGTACTCTCTTAGCTTCTTTCTTTTTGGTTAAATGTTATGGAACTACTATTCCTATTGGGCATATACTTATGACCATCACTGTGTTCAAGTATCAAGCTGGTTTTATATCCGTGTGCCTATGTACATTTGTATCCGCTTGGCCACGAGCTTTGGCTGCACTTGGCAAACTTAATAAATTAAACATTGAATCCTGCCTATTGCAACGATAATATAATCTGATTTAGTGCATTAAGAACGACAAGTAGCGATTATAATAGTAGATTTTAGCATTTGAGCTAAATTTATTTCCCAACCGCGTCTTGGGATTGCGTATGCGTGAGCCAGTACCTGCATGTGTGTGTGTTTTGGAATGTGGCCCTGCACGAAATTCAAATAGTGACCATCCTTGAGATTTTGCATACTGGCAAGATGGACGAGCACACGTTAAACGACCTGTTGGAGTGCTCCGTGTGTCTTGAGCGACTGGACACCACATCGAAGGTGCTGCCATGCCAGCACACCTTCTGCCGCAAATGCTTGCAGGTGAGTAATTGTTGTGGGTTTGCTACATATATATCATATAACCGAATGATTTCATCATTCTATGCCAGGACATTGTGGCCAGTCAGCACAAGTTGCGATGCCCGGAGTGCCGCATCCTGGTCTCTTGCAAAATTGATGAGCTGCCTCCAAACGTCTTGCTGATGCGAATCTTAGAAGGTAACAGCTAACGCCCAC CACAACAGCCTACGCTCAAAATCAAAGAATGGTTGACTTTATGAGTGCGGCAAAGTGGCTTTGGCAATTGAATATGGCGTTTACCTGGTCTTTACCTACCTTTAAACACCCTTTCTTTAATTCTCACAGGCATGAAACAAAATGCAGCAGCTGGCAAAGGAGAAGAAAAGGGAGAGGAGACTGAAACACAGCCGGAAAGGGCCAAACCTCAGCCGCCAGCGGAATCAGTGGCCCCGCCTGACAACCAACTACTCCAGCTGCAGTCACATCAGCAATCTCATCAGCCGGCTCGTCACAAGCAACGTCGATTTCTACTCCCCCACGCCTATGCCCTCTTTGACTTCGCCTCCGGTGAAGCCACCGATCTAAAGTTCAAGAAAGGGGATCTGATACTGATCAAGCATCGCATCGACAACAACTGGTTTGTGGGTCAAGCGAATGGTCAGGAGGGCACATTTCCCATCAACTACGTCAAGGTATCGGTTCCGCTGCCCATGCCGCAGTGCATTGCCATGTATGACTTTAAGATGGGGCCCAACGAC


Search Again