CR00920

CRIMIC CR00920

Gene Toll-4

CG18241

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79358

Images

Construct Sequences

sgRNA sequence
AGAGCTATTCGTGCCTTCCCCGG

Amplicon 5' Amplicon 3'
TTGCCACTTTGCCATTTCCGGTTTTGACGGCTCGGCGGGAATTTCTATTCCTTAGCCATAATTGCAAAGTTCCCGCTCCTGCGGCTCCTTGGGGCCTCAGCTCATCCCACAGGCTGTCCGCAAACAATTCCGAGTGATTTTCAATGTGTATGTGAATGAAATTAAGCAATTCCAATTTACCTAAGGTCCTTTCCCGCATCACTGAGTTCACGTAATGATTTCGCAAATGCAATAGCAAGAAAATTGTTTGAGACTTATGGAACTCATTTGAACAACACCAACAAATAATTACTGGTTGGTTTATTAAGAGGCCTTCAAATTACGGAATTTCAGTTAACTGTAGCAAATATGAACTTGAACATCTATTTAAGAATTAAAGCCGAATTCGCTACATGCATACAACCAGACAACTTGCTATTCATAACAACACCCGTTGACAATTGATTACGCATTACTACAATTTAATTATTAACATTAATATATCAATTTGTATTTAATTCATCCTTCCTGTGAAACAGAAATTTATTTGTCATTTATTAAATCTTTAATAATTGGCACGGTCTCTGTGTCAAGCCAACAAGCCTAATTAACATTTAAAATTATCAGCTGACATAAATTGTTTGATGACCATAAATATTTGTGCCGACGAGCGGAGGCAGAAAACTTTGCAGACAAGGCAATATGAAAAGCACAAAAGGACAATAAGGGTCCCAGTTCCGATTGCCGTTTTCCCCTTGCCACAAAAACAGAAAGAGAGGGCAACGGATAGCGCAGTAAAGAGACGGCAGCGAATAAAAAACAAATATATCAAAGCGAGCAAGGGGCATAAATGTAGCGTAATTTAAATAAAATTGCATTAATATGTTCTCTCCACCGAAAGGGATCTCCAGCTGCAGCCTGTGTCCTGGGCAAATTTCCAACCAAGAGAAGAGCTATTCGTGCCT GCCGGCCATAATTCATCTGGGAGGCAACAAAAACACACACAATCACACACCACACAACTATCGCCGGACCTCTGTTGCTCAGCAAATTCACACCAAAAATCAAAAAGCAATAATGATGCTCGAAATCTGAACAGCCGGGTCCGGGTCCGGGCTCGAGTTCGGGTTGTGCCTGGCGAGATGCGGATGGGAGGTGTGAAAAGTGGGCATGTCTGGGCCACTATAAATGCATGAGTGTGTGTTTGGGCTACGTGGCAAACTTTTCGAGTATTTGTCGTTATAAATTTGACATCAATTGCCACGGCATGTGACCAACGAAGGTCTGACAGTCCAGGAACAAGCCAGGCGGTTCCAGAGGTGGACGGACTACGGCTGAAGGAACGAAAAGGCGGTGAGGCACTGCTGAGGATGTGAGCCAAATTGCGAAAAAAAACAAGGCTCGATTTAGATATGGAAGGAGTAAATTTAAAAGGAAAAATATTTAATAAGGAGTATACTGCCAACCAAAACCCTTTTTACTCCTACAATTTTATTCGAGTAACTCGACTATCAGATACCGACTAAGTCGGTACGCTTGTGAGATCG


Search Again