CR00919

CRIMIC CR00919

Gene Liprin-gamma

CG11206

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79357

Images

Construct Sequences

sgRNA sequence
CTCTGCCCGTTCCACATCCCTGG

Amplicon 5' Amplicon 3'
CCCGGTCACAAGTTCATCCATGTGAATGACTGATGATGAACCCAAATTGATTGCACACACACCGCCAGGATAATCGTTATTCACATACAAATTCCCCTGTGGATAGGCATTATGCCATCTTTTTCAGCTTTTTTGCTTATTGATTGTCAACACGGATTTATTTTACGGCCAAGGATTTAAATGAAAATTTAATTAGCACTTAATGCGCGGCATGAAATCATTATAAAAGGCAAAAAAAATGCATACAGGAATTGAGGTCGAATGCTCTGCACTGTTTACCAAATAAAAACTACCAAATTGAAGAGTTAACTTTTATTCAAGTCCCAAAACTAAAGTGGCTGAATCACCACCCCCGCTCCCCGTTAAATTTTCAGCGTTTAAGTTTCGAAAGCCCAACTCGACCGCAACCACTTTGGGATCCACCGACTTTTTCACCTTCTCCGGAATGACCCCGCCTATCTGCTTCGTTGACTTTTCAACTGCAGCACTAAAAGCGATTGGTCGGAGCTCCTGGACGGACAGACGGACAGATGGGGGGGCAGATGGGCAAATGGTGCTTGTATCTCCAACGAACGGACGAAGGCCATTACCATCCATTTGTCAGATTTTTGAAGTGTGCATCACTTTGCCATTCTGATATAATCTGATGCGTTGACCAAGCCAAAAGACCAAGAGCAAAAAAAGGTACTCTGCCCGTTCC GAAACACCTAAGCCGCCACTGCATCCTCGTCCTGCGGACCTAGTTGTTTTGTCCTGCTGTGGCTGGCTTGTGGCTCTTACCCTCGGTTGCCACTGGTAGCTTGCAATCTGCCTGGCCACAGGACAACATTTAATTTCTTGCCCCTTTTGTGCCGCCAAATACTTTAGCAATTGCATTAAAACAAAACAAATGGGATTCAATATTTTACGCAGCCGGCAGATGGAATTAAATCAGCGTGCAGGTTGAAAGGATTCAATCAGGAACGCTGATTTAATTCCTTTTTGGCCGGCTCCCATTTGGCATTCCCACAGTGGCCAGCATTTGTTCATTCATGCCGCAAAGATCCTTGCCCCATGCCACAGGCCTCTACCGTTTCTCCAACCAACCCCCCCTTGCCCAAGGAAACTCCTTTCTTTGCCCGCAGCAATCTGCTGATTGCTCCCTCCGCTCACACCCGCGCGCTGCGCGTTTACACATTACAAATGCATTTGCATACGCTGAGCGAAAAGCCAAATCCAAACAGTAATTAAAATAAAATTGTATTAAATCAAATTAAGAAAAAATGCTCCTTTGCTGATCGTTTAGGATCATTACCAGCAATAACTATCCCCAAAGGAATTATCTTTTTTAAGGTAAGTATTTTTTCCCAGTGTACAAGCACCCTTGCAACAGAAGCCGCCGCTATCCCCCGCACACTTACCGGCATTGAGTGCACTGCCACTGGAGGGGGCGTTGTGGGCGGGGCCGGCTGCCTGTGCCAAGTGACCAGCGGCAATTAAATTCGAGTTATTCGCATGGATCATGGCTGTGCCGGAGTTGCAAGTGCTGCTGATGCCGTTGCTGTTGCTGTTGCAGTGGCTGCTGCCGATGCCATTCGGCAATTGCTGCTGCTGCTGTTGCTGCTGAGGCACTCCTCCTGCGGCTTCTGCTGGCTTGCCAGGATACGCAGGACTCCGGTGCTGGTGGTGCTGTAACTGCTGCTGGAGCGGCTGATTATCAGCGGTCATGGGTGGGGTGAGGGTCTGGTTGCTGCCATTCGAACTGGACGGCGATGAGCTGCTCTCGTTGCTGGGCGTGAGGTCTCGTTTGGAGGCCAAGA


Search Again