CR00912

CRIMIC CR00912

Gene CG15141

CG15141

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79356

Images

Construct Sequences

sgRNA sequence
CATTAGGCAGTCGAGGCCCTCGG

Amplicon 5' Amplicon 3'
CCAACCAAAGGCACGACTTGATTATTACCAAACCCTCGTTCCGTTGCATATTCAGGGCAAAAGCCTGACACAGTGGTATTACGCAGTCAATGGTGTCCAGAAAGTCAATAGCATAGTTATAGTCGCTCCTCTTGGCCAAATTGACTTTGAGATCATTGCGGGGCAGGCGATAGAGCTGGTAATATGATTGGTTGTCGATCTGCAAGTCATTCAGTCCACGAAACATCTGGTTGGGTATAACACGACCATCGGTCATCTTGTAAAAGGCTCCGCGTGGGCAAATGGCACACTCCTCTGTTATAATAAACACAATGGCTGCCAGCCGTTCCTCCTCCTTAAGCTTGACCACTTCAGGGCGGCTGATACCAGCCACCTGATTGCCTACGATGTCAAAAGTGGGGTCCTGTGTGCGTACAATATCAGAAAAACCACCACCACATTTACGTACTATCAACTCACCAGCTTAACGTAGGTCATCAGGCTGGGATCTCCTATAAATGGCTCCCTTGCCAATATAGTCGCCTGAAATATCTTGGGGCTCTGTACGAACGGCAGCAACTGCCATTGGAACTGGTCCAGACTGTAGAAATACTTGCGATCCTTGAGACAGTCATTAGTGTAGCCAAAGGCAATGTAGTAATCGTTCTTGGTGGCCGTAATGCGACCCCAAAGATACATGCCCGTAAAACGATTGTCATTTTGTAAAGCGATCAGCGAGTTTTCAATCAAGATGCGCTGCTCCGGCGACAGCTTCATGCCGCAGTACAT CCCTCGGTGAAGAACTCCAAATTCATGACGAAAGTATCTTAGCAATTTATATGTGAAGTGTTGAAATAAAATATGGATTTAAGTGCTGAGAGTATTTGAAAGAAAACTCAGAACCGTAAAAAAAAATATGTTAGCGGAATGGATTTTTAATTACATGGCATGCATAAATCAGCACAAACTCTTTGAACTGCCAATTTCCCCCATTTATTCATCTCTACCCTTTCTCTTTCAAGGAGCTGCTTTCTGGACAAATGACTGGCGAAAATCACTCTGTCAGTGCTCCGAATGCCTGTCGCTTTACAAGGAACTTGCCGTGGAGTTTCTGCTGGATGTCGAGGATTCGGCTAAGACGTACGAGGAGCGCGGCATGAAGCGGGCTGAAGAGAATTCCAGTTATGAGCAAGGAATCCGGGCACTGGCCTCCATTGACCGGACACAGCAAATCGATGCGATTACCGAATACAATCGCATGAAGGACAAGCTAAAGGAATACCTGCAGGCATTCGCCGCCAGCAAGAAGGTAGTGACCGAGGAGGATATCAATCGGTTCTTTGCCGGCATGCGCAATGAGAACAATGCCAACCTGGGTCAGCCCTATTTCTGTCGCTAAACAGTTAGCACTCTATATTACTCTAGTATTACCCACATTCCCCCATGAAAGCGAAACATACATACATACATCATGTAAATTCTAAAGTTATATTTTATTTAAACAATAATCATTTTCAATTCACTTTTGTCAATAACGAAAAGTCGTAACAAGGCATCGGGCAATGAGATTCGCATTTCCCTCATTAAATTTATGTACATTGCGGTAAAATAGAATTATATAAGACAGGTTTTGTGTTGAAGTTCATTTTGGATTGAGACCTTTTTACATGTAGCTCTAATTGGTTAATTTCCGATATATTTTATGAAATATATGTACACTAGTATTTAGCAAAGTTTGTTGTTCATTTGAATGGCTGAATTCCCAAGCTATTGAGTTCTGCCTCAATGTCCTGGATAAGTTCGCTGGTGTCAATGGGCGCCATGCCTATGCTGCTGGAAATTAGATCACTAAACGATTGGGTGGGTTCATCTGCTGGAGGTTGCTGCTCCTGTGGCTGCTGTTGCTGTTGGTACTGCGACTGTTCTGGATGGGATTGGGC


Search Again